JOURNAL TRANSCRIPT
Patrick F. Desmond Biochemistry and Molecular Biology University of Maryland School of Medicine 108 N. Greene St, Baltimore, MD 21201
[email protected] Education: Doctor of Philosophy, Biochemistry and Molecular Biology 08/2010 – 05/2016 University of Maryland Baltimore, Baltimore, MD Thesis Advisor, Robert J. Bloch, Ph.D. “Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle”. Bachelor of Science, Biochemistry and Molecular Biology The Pennsylvania State University, University Park, PA
08/2005 - 05/2010
Research Experience: Walter Reed Army Institute of Research, Silver Spring, MD 01/2009 – 08-2009 Undergraduate Researcher (Mentor: Julian R. Haigh, Ph.D.) Worked on project which tested efficacy of prophylactic drug used against chemical warfare agents. Graduate Course Work: Mechanisms in Biomedical Sciences Advanced Biochemistry Advanced Cancer Biology Introduction to Membrane Biophysics Advanced Molecular Biology Topics in Molecular Medicine Muscle: Excitation-Contraction Coupling Ion Channels Muscle Cell Biology and Development Research Ethics Entrepreneurship in Life Sciences
A A B A AAA A Audit P A
Teaching Experience Assistant mentor Instructed lab technicians, graduate students, and post-doctoral fellows to perform several biochemical methods Provided guidance on experimental design Guest lecturer and Tutor Presented portion of special topics lecture in the ‘Mechanisms in Biomedical Sciences’ course Provided one-on-one tutoring with first year students
Abstracts Desmond P. F., Muriel J. M., Markwardt M. L., Rizzo M. A., Bloch R. J. Interactions between sAnk1 and SLN coordinately modulate SERCA activity. Joint symposium for musculoskeletal research. 2015. Desmond P. F., Muriel J. M., Markwardt M. L., Rizzo M. A., Bloch R. J. Identification of small ankyrin 1 (sAnk1) as a novel SERCA1 regulatory protein in skeletal muscle. Biophysical Journal, Vol. 108, Late Abstracts. 2015. Garcia-Pelagio K. P., Muriel J. M., O’Neill A., Desmond P. F., Lovering R. M., Lund L., Bond M., Bloch R. J. Myopathic Changes in Murine Skeletal Muscle Lacking Synemin. Biophysical Journal, Vol. 108, Issue 2, p424a. 2015. Peer-Reviewed Journal Articles Desmond P. F., Muriel J. M., Markwardt M. L., Rizzo M. A., Bloch R. J. Identification of Small Ankyrin 1 as a Novel Sarco(endo)plasmic reticulum Ca2+-ATPase 1 (SERCA1) Regulatory Protein in Skeletal Muscle. Journal of Biological Chemistry. 2015. Garcia-Pelagio K. P., Muriel J. M., O’Neill A., Desmond P. F., Lovering R. M., Lund L., Bond M., Bloch R. J. Myopathic Changes in Murine Skeletal Muscle Lacking Synemin. Am. J. of Physiology. 2014. Mueller A.L., Desmond P.F., Hsia R.C., Roche J.A. Improved immunoblotting methods provide critical insights into phenotypic differences between two murine dysferlinopathic models. Muscle and Nerve. 2014. Haigh J.R., Adler M., Apland J.P., Deshpande S.S., Barham C.B., Desmond P.F., Koplovitz I., Lenz D.E., Gordon R.K. Protection By Pyriodostigmine Bromide of Marmoset Hemi-Diaphragm Acetylcholinesterase Activity After Soman Exposure. Chemico-Biological Interactions. 187: 416-420, 2010. Funding: Training Grant in Membrane Biology (5T32GM008181-25, Dr. Matthew C. Trudeau , P.I.) Pre-doctoral fellowship (2011-2012) Interdisciplinary Training Program in Muscle Biology (5T32AR007592-17, Dr. Martin F. Schneider, P.I.) Pre-doctoral fellowship (2012-2014) Select Communications: “Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle,” oral presentation, Interdisciplinary retreat in muscle and membrane biology, Baltimore, MD (2015). “Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle,” oral presentation, Graduate Research Conference, Baltimore, MD (2015).
“Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle,” poster presentation, 59th Annual Biophysical Society Meeting, Baltimore, MD (2015). “Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle,” poster presentation, Annual Retreat in Biochemistry, University of Maryland Baltimore (2014). “Identification of sAnk1 as a novel SERCA1 regulatory protein in skeletal muscle,” oral presentation, Student Seminar Series, University of Maryland, Baltimore (2014). “Investigating the interplay between SERCA1, sAnk1 and Sarcolipin in the SR membrane of skeletal muscle,” poster presentation, Graduate Research Conference, University of Maryland Baltimore (2014). “Investigating the interaction between SERCA1 and small ankyrin 1 in the SR membrane of skeletal muscle,” poster presentation, Annual Retreat in Biochemistry, University of Maryland Baltimore (2013). “Small Ankyrin 1 interacts with SERCA1 within the network SR of skeletal muscle,” oral presentation, Membrane Biology Student Seminar Series, University of Maryland Baltimore (2013). Professional Societies Biophysical Society Member
2014-present
Service Activities School of Medicine Council (student representative) Biochemistry program student recruitment assistant GPILs award committee GPILs course tutor
2011-present 2011-present 2013 2011-2012
Honors and Awards Best research talk: Annual retreat for Muscle and Membrane Biology Glaser Prize in Imaging Gerth CR Scholarship Giangiordano Science Scholarship Pennsylvania State University Deans List
2015 2013 2009-2010 2008-2009 2005-2010
ABSTRACT Title of Dissertation: Identification of Small Ankyrin 1 as a novel SERCA1 regulatory protein in Skeletal Muscle Patrick F. Desmond, Doctor of Philosophy, 2016 Dissertation directed by: Robert J. Bloch, Ph.D., Professor, Department of Physiology Small Ankyrin 1 (sAnk1) is a ~20 kDa transmembrane (TM) protein that binds to the cytoskeletal protein, obscurin, and stabilizes the network sarcoplasmic reticulum (nSR) in skeletal muscle. Previous reports from out lab show that sAnk1 knock down results in loss of network SR integrity, along with a decrease in SR Ca2+ load and Ca2+ reuptake rates. Upon closer examination of the sAnk1 transmembrane domain, we discovered that sAnk1 shares sequence similarity with sarcolipin (SLN), a small protein that inhibits activity of the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA). The goal of the current study was to determine if sAnk1 interacts with SERCA1 or SLN directly in skeletal muscle, and elucidate the consequences such interactions pose on SERCA1 activity. Our results indicate that sAnk1 interacts specifically with SERCA1 in SR vesicles isolated from rabbit skeletal muscle, and in COS7 cells transfected to express these proteins. This interaction was demonstrated by co-immunoprecipitation and an anisotropy-based FRET method (AFRET). Binding was significantly reduced by the replacement of all the TM amino acids of sAnk1 to leucines by mutagenesis. This suggests that, like SLN, sAnk1 interacts with SERCA1 via its TM domain. Assays of ATPase activity show that co-expression of sAnk1 with SERCA1 leads to a reduction of SERCA1’s apparent Ca2+ affinity, but that sAnk1’s effect is less than that of SLN. Interestingly, the sAnk1 TM mutant has no effect on SERCA1 activity. Our results suggest that sAnk1 interacts with SERCA1 through its TM domain to regulate SERCA1 activity and thereby modulate the sequestration of Ca2+ in the lumen of the ER and SR.
Additionally, we determined that sAnk1 can also interact with SLN using the same analytical methods. Unexpectedly, ATPase assays in which all three proteins were coexpressed showed that sAnk1 was able to limit SLN’s ability to inhibit SERCA1 activity. Furthermore, coIP and AFRET experiments demonstrate that SLN promotes the interaction between SERCA1 and sAnk1. The identification of sAnk1 as a novel regulator of SERCA1 activity has significant implications for the physiology of muscle and the development of therapeutic approaches to treat heart failure and muscular dystrophies linked to Ca2+ misregulation.
Identification of Small Ankyrin 1 as a novel SERCA1 regulatory protein in Skeletal Muscle
by Patrick F. Desmond
Dissertation submitted to the Faculty of the Graduate School of the University of Maryland Baltimore in partial fulfillment of the requirements for the degree of Doctor of Philosophy 2016
© Copyright 2016 by Patrick Desmond All rights reserved
Dedication To my family and friends for their support.
iii
Acknowledgments I want to thank Dr. Robert J. Bloch for his guidance over the last 5 years. His scientific knowledge and ability to effectively communicate with his students is truly inspirational. The optimism and excitement he has toward the science going on in our lab is both motivating and admirable. In addition to developing into a better scientist, Dr. Bloch has further prepared me to succeed in all aspects of life, and for that I am grateful. Next I would like to thank the members of the Bloch laboratory, both past and present, for graciously providing me with their assistance and expertise. Specifically I want to thank Wendy Resneck for teaching me about protein biochemistry; Andrea O’Neill, Amber Mueller, Alyssa Collier, and Sankeerth Manne for their assistance with animal work; Joaquin Muriel for his help with molecular cloning; and Yinghua Zhang for teaching me protein purification techniques. I also want to thank Dr. Mark Rizzo and Michele Markwardt with whom we collaborated for the AFRET experiments. This technique was a major component to my research, and without their help much of my work would not have been possible. Thanks to both of you for providing your expertise, equipment, and time. Additional thanks go to Dr. David MacLennan for providing us with several cDNA constructs utilized in my research, and both Dr. Sana Shaika and Dr. Eva Chin for their assistance in troubleshooting the assays for measuring Ca2+ ATPase activity. Finally I would like to thank my advisory committee, Dr. Robert Bloch, Dr. Aikaterini Kontrogianni-Konstantopulos, Dr. Martin Schneider, Dr. Christopher Ward, and Dr. Elsa Garcin for the time and insights they provided over the years. iv
TABLE OF CONTENTS Chapter I. Introduction ................................................................................................................. 1 A. Skeletal Muscle ...................................................................................................................... 1 i. Structural Overview ............................................................................................................ 1 ii. Skeletal Excitation-Contraction Coupling ....................................................................... 2 B. The Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) Pump ................................... 4 i. SERCA Isoforms ................................................................................................................. 4 ii. Regulation of SERCA Activity .......................................................................................... 6 C. Ankyrin proteins: a brief review ....................................................................................... 12 D. Small Ankyrin 1 (sAnk1) .................................................................................................... 14 E. Network SR Integrity Depends on sAnk1 .......................................................................... 18 F. Research Significance and Goals ........................................................................................ 19 Chapter II. Identification of sAnk1 as a Novel SERCA1 Regulatory Protein in Skeletal Muscle ............................................................................................................................................ 30 A. Abstract ................................................................................................................................ 30 C. Experimental Procedures.................................................................................................... 33 D. Results ................................................................................................................................... 40 E. Discussion ............................................................................................................................. 47 Chapter III. Interactions between Small Ankyrin 1 and Sarcolipin Coordinately Modulate Activity of the Sarco(endo)plasmic Reticulum Ca2+-ATPase (SERCA1) ................................ 70 A. Abstract ................................................................................................................................ 70 B. Introduction.......................................................................................................................... 70 C. Experimental Procedures.................................................................................................... 73 D. Results ................................................................................................................................... 77 E. Discussion ............................................................................................................................. 81
v
Chapter IV. Small Ankyrin 1 levels are reduced in the mdx mouse model of Duchenne’s Muscular Dystrophy..................................................................................................................... 96 A. Abstract ................................................................................................................................ 97 B. Introduction.......................................................................................................................... 98 C. Experimental Procedures.................................................................................................. 100 D. Results ................................................................................................................................. 101 E. Discussion ........................................................................................................................... 102 Chapter V. Comprehensive discussion, preliminary studies, and future direction.............. 111 A. Characterization of the interaction between sAnk1 and SERCA1 ............................... 111 B. Determining if sAnk1 and SLN bind SERCA1 simultaneously ..................................... 113 C. C34 of sAnk1 mediates homodimerization via disulfide linkage ................................... 116 D. SLN promotes interaction between sAnk1 and Obscurin .............................................. 117 E. sAnk1 expression is reduced in aging mouse skeletal muscle tissue.............................. 119 F. The role of sAnk1 in other tissues. .................................................................................... 121 Bibliography................................................................................................................................ 132
vi
LIST OF TABLES Table 1.1. The ATP2A Family of Genes ..................................................................................... 22 Table 2.1. ATPase Assays ............................................................................................................ 54 Table 3.1. ATPase Assays ............................................................................................................ 86 Table 4.1. Expression levels of SERCA1, sAnk1, and SLN in mdx tissue. ............................ 106
vii
LIST OF FIGURES Figure 1.1. Skeletal Muscle Structure ......................................................................................... 23 Figure 1.2. The Membrane Systems of a Skeletal Muscle Fiber. ............................................. 24 Figure 1.3. Domains of SERCA ................................................................................................... 26 Figure 1.4. SERCA Reaction Cycle ............................................................................................. 27 Figure 1.5. Small Ankyrin and Comparative Sequence Alignment ......................................... 28 Figure 2.1. Sequence comparison in transmembrane regions of sAnk1 and SLN ................. 55 Figure 2.2. CoIP of SERCA and sAnk1 from rabbit skeletal muscle. ..................................... 57 Figure 2.3. CoIP of SERCA and sAnk1 from COS7 cells. ........................................................ 58 Figure 2.4. Colocalization of fluorescent fusion proteins in COS7 cells. ................................. 60 Figure 2.5. AFRET of sAnk1 and SERCA and SLN and SERCA in COS7 cells. .................. 62 Figure 2.7. The cytoplasmic domain of sAnk1 directly interacts with SERCA1 in vitro. ...... 66 Figure 2.8. Modeling the sAnk1 TM domain. ............................................................................ 68 Figure 3.1. CoIP of sAnk1 and SLN from rabbit skeletal muscle and COS7 cells. ................ 88 Figure 3.2. Colocalization of sAnk1 and SLN and sAnk1, SERCA1, and SLN in COS7 cells. ................................................................................................................................................ 89 Figure 3.3. AFRET of sAnk1 and SLN in COS7 cells. .............................................................. 91 Figure 3.4. SLN promotes interaction between SERCA1 and sAnk1. ..................................... 92 Figure 3.5. SLN promotes interaction between sAnk1’s cytoplasmic domain (sAnk29-155) and SERCA1. ....................................................................................................................................... 94 Figure 3.6. Ca2+-ATPase assays. .................................................................................................. 95 Figure 4.1. Immunoblot comparison of control and mdx mouse muscle tissue. ................... 107 Figure 4.2. Graphical comparison of control and mdx mouse muscle tissue. ....................... 109
viii
Figure 4.3. Comparison of Ca2+ handling proteins in dysferlinopathic mouse model (BlaJ)............................................................................................................................................ 110 Figure 5.1. sAnk1 transmembrane mutant sequence. ............................................................. 123 Figure 5.2. Dimerization of sAnk1 through chemical crosslinking. ....................................... 124 Figure 5.3. Cysteine 34 mediates sAnk1 dimerization. ........................................................... 125 Figure 5.4. Dimeric sAnk1 preferentially interacts with obscurin and the interaction is enhanced by SLN. ....................................................................................................................... 126 Figure 5.5. sAnk1 levels are reduced in aging mouse muscle tissue. ...................................... 128 Figure 5.6. Alterations of sAnk1 and SLN in aging, dysferlinopathic mouse muscle tissue. ........................................................................................................................................... 130
ix
Chapter I. Introduction A. Skeletal Muscle i. Structural Overview Skeletal muscle is a type of striated muscle tissue which in men and women, accounts for 42% and 36% of their average body weight, respectively (1). The organization of skeletal muscle is uniquely structured in a repetitive manner. A single muscle is made up of bundles of muscle fibers, each of which is a single multinucleated cell (or myocyte; Fig 1.1). Each fiber is composed of myofibrils which extend the length of the muscle fiber. Myofibrils are made up of thick and thin filaments which are arranged into the repeating unit of muscle known as the sarcomere. The thin and thick filaments of the sarcomere are composed primarily of actin and myosin, respectively, and are the major components required for muscle contraction. When visualized under a light microscope, the thin and thick filaments appear as alternating light (I-bands; isotropic) and dark (A-bands; anisotropic) bands, giving the characteristic striated pattern associated with striated muscle (Fig. 1.1). The Z-disk defines the sarcomeric boarder and serves to anchor one end of the actin thin filaments (2, 3). The center of the sarcomere is referred to as the M-band, from which the thick filaments extend out symmetrically in each direction to form the A-band (4). Overlap between A- and I-bands allows formation of crossbridges between actin and myosin which mediate muscle contraction. Striated muscle cells are surrounded by a plasma membrane linked to cytoskeletal and extracellular structures, together called the sarcolemma. It also contains two specialized intracellular membrane compartments known as the transverse tubules (ttubules) and sarcoplasmic reticulum (SR; Fig. 1.2). These membrane systems surround 1
each myofibril and together regulate changes in the intracellular calcium ion concentration, [Ca2+]i, associated with muscle contraction and relaxation. The t-tubule system appears as invaginations of the sarcolemma and, in skeletal muscle, resides at the edge of the sarcomere near the junction between A-bands and I-bands. This differs from cardiac muscle, where t-tubules surround the Z-disk. The SR serves as an internal storage compartment for Ca2+ and is composed of two distinct regions, the junctional SR (jSR or terminal cisternae) and the network SR (nSR). The jSR is located on either side of the t-tubule system in skeletal muscle and is the site where Ca2+ release takes place. The structure in which a t-tubule is flanked on either side by jSR is referred to as the triad junction. Between each consecutive jSR lies the mesh-like nSR, which is the primary site where Ca2+ is transported from the cytosol back into lumen of the SR. The coordinated activity of these membrane systems is pivotal to the processes of excitation-contraction coupling and subsequence muscle relaxation. ii. Skeletal Excitation-Contraction Coupling The activation of skeletal muscle begins when an action potential arising in the motor neuron is conducted along the axon to the nerve terminus at the neuromuscular junction. Synaptic transmission results in depolarization of the postsynaptic membrane of the muscle cell, inducing an action potential that spreads along the sarcolemma and deep into the myofiber along the t-tubules to initiate the process of excitation-contraction (EC) coupling (5, 6). The change in membrane potential of the t-tubules first activates the voltage-gated L-type calcium channel, or dyhydropyridine receptor (DHPR). In skeletal muscle, the DHPR is mechanically coupled to the SR calcium release channel (Ryanodine receptor; RyR1 (7)). Each RyR monomer consists of ~ 5000 amino acids 2
and has a molecular weight of ~565 kDa (8). Four RyR molecules come together within the SR membrane to form a ~ 2.2 MDa homotetrameric channel. The four RyR monomers extend toward the t-tubules where they form end-feet to which 4 DHPR molecules bind to form a tetrad (9). This physical link couples the conformational change from DHPR activation to opening of RyR and subsequent SR Ca2+ release. In addition to RyRs and DHPRs, several other proteins such as junctophilin (JPH), junctin (JCN), triadin (TRDN), and calsequestrin (CSQ) form a stable macromolecular complex referred to as calcium release units (CRUs; (10, 11). Although the same components are involved for EC coupling in cardiac tissue, it is important to note that the mechanism is different. Release of Ca2+ through the RyR in the heart is induced via Ca2+ influx through the DHPR, a phenomena known as calcium-induced calcium release (CICR; (12)) A relaxed muscle is so because the myosin heads are not attached to the surrounding actin filaments due to steric hindrance. This physical blockage between myosin and actin is governed by tropomyosin (13, 14). Each heterodimeric tropomyosin molecule aids to stabilize the actin filament and binds a Ca2+ -responsive regulatory complex called troponin (14). The troponin complex is comprised of three distinct subunits which together regulate myosin’s accessibility to actin. The rapid increase in [Ca2+]i in response to muscle activation relieves troponin-mediated inhibition of actinmyosin crossbridge formation. Actomyosin crossbridge cycling converts the chemical energy stored in ATP to mechanical energy and is responsible for muscle contraction (15). Muscle relaxation occurs by removal of Ca2+ from the cytosol, which is mediated primarily by the activity of the sarco(endo)plasmic reticulum Ca2+ ATP-ase (SERCA) within the nSR (16, 17). SERCA uses ATP to transport Ca2+ against its concentration
3
gradient from the myoplasm back into the lumen of the SR (18). This activity replenishes the SR Ca2+ stores, and primes the muscle for its next round of activation and contraction. The process of EC coupling in skeletal muscle relies almost entirely on Ca2+ from the SR. As the calcium gradient across the SR membrane is thought to be ~10,000-fold, ([Ca2+]SR ~2mM vs. [Ca2+]I < 100nM;(19-22) ) the mechanisms which regulate SERCA activity are critical (23, 24). B. The Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) Pump i. SERCA Isoforms As mentioned above, SERCA is the primary enzyme responsible for muscle relaxation, which acts by transporting Ca2+ from the cytosol into the lumen of the SR following contraction. The expression of SERCA is not limited to muscle cells, however. This ~110 kD integral membrane protein belongs to the P-type family of ATPases, which includes members such as the plasma membrane Ca2+-ATPase (PMCA), the Na+/K+ ATPase, and the K+ and H+-ATPase (25). A common characteristic among P-type ATPases is phosphate transfer from ATP to a conserved aspartic acid residue during the catalytic cycle, producing a conformational change associated with ion transport (18, 26, 27). In mammals, SERCA is encoded by three genes (ATP2A1-3), which produce at least 14 isoforms through alternative splicing (28) . The SERCA1a/b isoform, which is encoded by the ATP2A1 gene, is found only in fast-twitch skeletal muscle. The ATP2A2 gene encodes various isoforms of SERCA2. SERCA2a is expressed in cardiac muscle and slow-twitch skeletal muscle, while SERCA2b is ubiquitously expressed at low levels in muscle and non-muscle cell types alike. A third SERCA2 isoform, SERCA2c, was 4
also found to be expressed in cardiac muscle (29). More recently, mRNA was discovered in skeletal muscle for a SERCA2d isoform, but details regarding its expression at the protein level are lacking. The six known SERCA3 isoforms, encoded by the ATP2A3 gene, are mainly associated with non-muscle cell types such as hematopoietic cells, fibroblasts, and epithelial cells (29). In addition to the tissue-dependent expression of SERCA variants, isoform switching is also known to occur at different stages of development. For example, neonatal fast-twitch skeletal muscle fibers express a combination of SERCA2a and 1b, which is replaced entirely by SERCA1a in adulthood (30). While each of the SERCA isoforms functions to pump Ca2+ against its concentration gradient, they operate at different kinetic rates. These differences in activity are likely to account for the unique Ca2+ handling properties of each fiber type, cell type, or stage of development. All the isoforms of SERCA share a highly conserved amino acid sequence (75% or greater), leading to a nearly identical tertiary structure (Fig. 1.3; (29)). Each has ten transmembrane (TM) spanning helices connected by short lumenal loops, and a cytoplasmic headpiece consisting of three distinct domains; the actuator (A), nucleotide binding (N), and phosphorylation (P) domains. The TM region of SERCA comprises two sites where Ca2+ binds in a cooperative manner. The binding and hydrolysis of ATP by the N domain leads to conformational changes within the headpiece that are transmitted to the TM domains, changing the orientation and affinities of the 2 Ca2+ binding sites. Ultimately, the coordinated structural changes result in the transport of 2 Ca2+ ions from the cytosol to the SR lumen. An immense amount of X-ray crystallographic research devoted to characterizing SERCA’s structure at each point within its reaction cycle has
5
significantly furthered our understanding on this process (18, 27). Briefly, SERCA exists in one of two major conformations; the high Ca2+ affinity, E1 conformation, in which the Ca2+ binding sites face the cytosol, and the low affinity, E2 conformation where they face the SR lumen. As can be inferred from the reaction cycle diagrammed in Fig. 1.4, this description is grossly oversimplified (see (27, 31) for more details on SERCA’s reaction cycle). In addition to the structural and functional similarities shared among SERCA isoforms, these proteins are inhibited and regulated similarly. The chemical compounds thapsigargin (TG) and cyclopiazonic acid (CPA) are, respectively, potent irreversible and reversible inhibitors of all SERCA isoforms and are commonly used as experimental tools (32-36). Physiologically, several protein regulators of SERCA activity have been identified to date. Proteins such as BCL-2, presenilin, HAX-1, myoregulin (MLN), phospholamban (PLN), and sarcolipin (SLN) have all been reported to regulate the activity of specific SERCA isoforms (37-41). Of these, PLN and SLN are the most thoroughly studied and understood. ii. Regulation of SERCA Activity The ubiquitous expression of SERCA in eukaryotic cells highlights its importance in maintaining Ca2+ homeostasis in muscle- and non-muscle cells alike. Alterations in its expression and activity have been linked to several human diseases including muscular dystrophies, cardiomyopathies, and genetic disorders such as Brody myopathy and Darier’s disease, and will be discussed in greater detail in the following section. For these reasons, the mechanisms which regulate SERCA activity have been extensively researched over the last several decades. The homologous transmembrane proteins, 6
phospholamban and sarcolipin, are both well established as endogenous regulators of SERCA activity. In this section I will briefly review how these proteins function. . Phospholamban (PLN) is a 52 amino acid (a.a.; ~6 kDa) transmembrane protein that was first identified by Tada et al. in 1974 (42) as an inhibitor of SERCA2a and cardiac contractility. In striated muscle, Phospholamban expression varies with fiber type (43). Higher expression is observed in ventricular muscle compared to atrial muscle (~3-fold difference; (44)), and low levels are also found in slow-twitch skeletal muscle fibers (45-47). The homologous protein sarcolipin (SLN), first characterized by Odermatt et al. in 1997 is even smaller than PLN, consisting of only 31 amino acid residues (~4 kDa; (48)). Unlike PLN, SLN is most highly expressed in atrial muscle and fast-twitch skeletal muscle (44, 49, 50). PLN and SLN have both been shown to interact directly with SERCA1 and SERCA2 within the SR membrane by binding to a pocket made up by TM helices M2, M4, M6 and M9 of SERCA (51). Binding of either protein is associated with a reduction in SERCA’s apparent Ca2+ affinity. More recent studies indicate that PLN and SLN each regulate SERCA using distinct mechanisms of action, suggesting a higher level of complexity than once believed. Much of what was known early on about SERCA regulation by PLN and SLN was from research conducted by MacLennan et al. (48, 51-57). Using Ca2+-uptake assays in microsomes isolated from HEK293 cells transfected with various combinations of cDNAs, they showed that PLN and SLN both function to reduce SERCA’s apparent Ca2+ affinity as measured by a reduced KCa2+ ([Ca2+] resulting in half-maximal activation). Additionally, mutagenesis studies helped determine the specific amino acid residues responsible for this effect, many of which are located in the TM helices noted above.
7
Interestingly, co-expression of both PLN and SLN with SERCA was found to result in synergistic inhibition (54). This was initially thought to be a result of SLN-mediated depolymerization of PLN pentamers to inhibitory monomers (54), but, later studies suggested that superinhibition was due to the formation of a SERCA-PLN-SLN ternary complex (51, 57). A recent study showed that co-expression of PLN and SLN occurs in human myofibers and suggests superinhibition may be a physiologically relevant phenomena. As previously mentioned, PLN and SLN modulate SERCA activity by distinct mechanisms. It is well established that PLN’s ability to reduce SERCA’s apparent Ca2+ affinity is dependent upon the phosphorylation state of its cytoplasmic N-terminus, consisting of 30 amino acids (49). Specifically, phosphorylation of residues Ser17 and Thr17 is mediated by protein kinase A (PKA) and Ca2+/calmodulin kinase (CamKII) through β-adrenergic stimulation (42, 58-62). Phosphorylation promotes dissociation of inhibitory PLN monomers from SERCA. When dissociated, phosphorylated PLN tends to form homopentamers, which are thought to be non-inhibitory (63). It has recently been shown that PKA has a higher affinity for pentamers of PLN, and is suggested to serve as a mechanism of attenuating PKA-dependent phosphorylation of PLN monomers (63). In addition to phosphorylation, Ca2+ itself is sufficient to dissociate PLN from SERCA at high concentrations (64, 65). The resulting effect of PLN dissociation is to increase SERCA’s apparent affinity for Ca2+. This increase in SERCA’s apparent Ca2+ affinity promotes elevated activity at lower [Ca2+]i, and ultimately results in an increased rate of muscle relaxation (66). Higher levels of SERCA activity associated with the dissociation of PLN are also associated in the heart with increases in the SR Ca2+ load
8
and more forceful contractions, while having no effect on heart rate (66, 67). Experiments with animal models agree with in vitro studies and show that elimination of PLN expression by homologous recombination results in increased relaxation rates and cardiac contractility (67), with overexpression having the opposite effect (68). Like PLN, the ability of SLN to modulate SERCA activity in cardiac myocytes is also regulated via phosphorylation of its cytoplasmic sequence, which extends from amino acids 1 – 7 (49). Phosphorylation of SLN at Thr5 is specifically catalyzed by serine threonine protein kinase 16 (STK16(69) and CaMKII (70), which are both thought to be activated following β-adrenergic stimulation in cardiac tissue. Phosphorylation of SLN is also associated with a relief of SERCA inhibition due to increases in SERCA’s affinity for Ca2+. Consistent with this, studies in which SLN was overexpressed in cardiomyocytes or hearts of transgenic mice both showed reduced rates of Ca2+ transport and decreased cardiac contractility (49, 50). Other studies have demonstrated that alterations of SLN expression in atrial muscle are linked to atrial fibrillation and heart failure (71, 72). These studies suggest that SLN plays an important role to regulate SERCA2 in atrial muscle similar to that of PLN in ventricular muscle, and that small changes in its expression level may be relevant to human disease. While there are many parallels between SLN and PLN in their ability to regulate SERCA activity in cardiac muscle, recent studies have shed light on a more complex role for SLN in skeletal muscle. The remainder of this section will highlight research focused toward elucidating SLN’s role in regulating SERCA activity differently than PLN in skeletal muscle. The details regarding the mechanism behind SLN’s ability to reduce SERCA’s apparent Ca2+ affinity are not as clear, as the literature is contradictory. Initial
9
experiments using Ca2+ uptake or ATP hydrolysis were considered interchangeable methods for measuring SERCA activity. Smith et al. were the first to suggest this may not be the case as they found that SLN had no effect on SERCA ATPase activity, but markedly reduced Ca2+ accumulation within reconstituted lipid bilayers (73). In agreement with this result, several additional reports using a Sln-/- mouse have found that SLN reduces Ca2+ uptake while having little effect on ATPase activity. Together, they found that SLN promotes slippage of SERCA resulting in uncoupling of Ca2+ transport from ATP hydrolysis, and ultimately in increased heat production (74-77). Some of the most recent work on SLN’s thermogenic role have come from the Periasamy laboratory. In a series of publications, they report that SLN was required for muscle-based nonshivering thermogenesis and maintenance of body temperature in mice (78). Furthermore, their results suggest that SLN is a key regulator of basal metabolic rate, as SLN-null mice are prone to obesity while SLN over-expressing mice are resistant when fed a high calorie diet (78, 79) For a detailed review covering SLN’s role in muscle based thermogenesis please refer to (80). These reports open up a new possibilities by which skeletal muscle, and specifically SLN expression within skeletal muscle, could be targeted to manipulate energy expenditure and potentially combat obesity. In contrast, other reports have shown that SLN can reduce SERCA’s ATPase activity (81-84). Gorski et al. found that SLN significantly reduced SERCA’s Vmax and KCa2+, and that the highly conserved lumenal extension of SLN’s C-terminus was important for this effect (84). Another group used an antibody to SLN to disrupt its interaction with SERCA in homogenates of human vastus lateralis muscle (83).
10
Interestingly, they found that addition of the anti-SLN antibody resulted in increased ATPase activity, consistent with the idea that SLN is inhibitory. One possible reason for the discrepancy between these two sets of results is the way the assays were performed. Several of the examples which show that SLN inhibits SERCAs ATPase activity were assayed with the Ca2+ ionophore, A23187, present, which prevents the buildup of a concentration gradient and subsequent ‘back inhibition’ of SERCA. In most of the aforementioned experiments in which SLN had no effect on SERCA ATPase activity the ionophore was omitted from the assay. It is reasonable to speculate that under conditions in which the Ca2+ gradient builds up to high levels that slippage would be more likely to occur ((77) but see (75)). The ATPase assays reported in this thesis were performed in the presence of A21387 and used SERCA+SLN as a positive control for the ability to measure inhibition of SERCA activity. The data reported here are consistent with the observation of Gorski et al that SLN reduces the affinity of SERCA for Ca2+ (77, 84), and will be discussed in detail in chapter 2. Another interesting topic of research has been to investigate self-association of PLN and SLN, and their ability to interact with one another. As previously stated, PLN exists in monomeric and pentameric forms (85, 86), and the flux between these states is largely regulated via phosphorylation (61, 69, 70, 87). SLN also oligomerizes to form homodimers and higher order homooligomers (88). Heterodimers between PLN and SLN have also been shown to form, and may account for the observation that together these proteins synergistically inhibit SERCA activity (54). These interactions are believed to occur via leucine/isoleucine zipper interactions within their TM domains (86, 89, 90). Interestingly, we have found that the protein discussed here, small ankyrin 1
11
(sAnk1), shares the tendency to self-associate to form dimers and larger oligomers (91). Additionally, we have found that sAnk1 is able to bind to SLN (see chapter 3), presumably through similar hydrophobic leucine/isoleucine zipper interactions. Significant advances have been made in recent years towards understanding SLN’s specific and unique role in regulating SERCA activity. More work, however, will be required to understand the details regarding how it alters skeletal muscle thermodynamics. As previously mentioned, the observation that certain muscle fibers coexpress SLN and PLN, as well as SERCA1 and SERCA2 isoforms, adds further complexity to understanding the dynamic interactions among these proteins. Furthermore, the discovery of novel SERCA regulators which are also expressed in tissue containing SERCA, SLN and PLN, such as MLN and, as this thesis demonstrates, sAnk1, highlights the challenge of fully understanding how SERCA is regulated in striated muscle fibers. The range of diseases which have been linked to aberrant SERCA expression or function, or from general calcium dysregulation make this an exciting field for further research. C. Ankyrin proteins: a brief review The ankyrin protein superfamily is encoded in vertebrates by the ANK1, ANK2, and ANK3 genes. These genes, which are highly subject to alternative splicing, encode the various isoforms of AnkR, AnkB, and AnkG, respectively (92-95). Originally, ankyrin was identified as a large ~220 kDa erythrocytic protein which linked the spectrin cytoskeletal network to the anion exchanger 1 (AE1, band 3, SLC4A1) in the membrane of the red blood cell (96, 97). Ankyrins are now well known to be ubiquitously expressed proteins which generally serve as a link between membranes and networks of proteins 12
that form intracellular scaffolds. In addition to playing a role as molecular adapters, the proteins of the ankyrin superfamily all share a similar structural organization. Ankyrins typically consist of an N-terminal domain composed of ankyrin repeats, a spectrin binding domain, a death domain, and a C-terminal domain believed to regulate the activities of the rest of the molecule (98). The N-terminal domain is usually comprised of 24 ankyrin repeats and is commonly involved in mediating protein-protein interactions (99, 100). Striated muscle is known to express various ankyrin isoforms. A ~220 kDa canonical isoform of AnkB is expressed in cardiac tissue, where it localizes to membranes at the level of Z-disks and M-bands. Here, AnkB coordinates the assembly of ion channels and transporters of the t-tubule and SR including Na+/Ca2+ exchanger, Na+/K+ ATPase, Kir6.2 and IP3R (101-103). Mutation or loss of AnkB has been associated with several human diseases including type 4 long QT syndrome, cardiac arrhythmia, and more recently, heart failure (94, 101, 104-106). Skeletal muscle also expresses various isoforms of AnkG and AnkR. It has been reported that the ANK3 gene produces at least six AnkG isoforms in striated muscle, which all possess a 76 amino-acid C-terminal insert found only in muscle (107). These include large, canonical, AnkG isoforms with a molecular weight of 217 kDa and 197 kDa, and four smaller isoforms ranging between 107 and 130 kDa. Each of these AnkG proteins contains a unique insert, which was termed the “Obscurin/Titin-Binding-related Domain” (OTBD) by Maiweilidan et al., and was shown to interact with plectin and filamin-C (93). They found colocalization between ankyrin-G, plectin, and filamin-C at costameres. Their results suggested that these interactions may be important for sarcolemma integrity
13
during force transduction through costameres by linking ankyrin-G to the dystrophinassociated glycoprotein and integrin-based protein complexes (93). The ANK1 gene transcript also produces several alternatively spliced isoforms of AnkR (more commonly referred to as Ank1) in striated muscle. This includes the canonical ~200 kDa Ank1 localized at the sarcolemma and several smaller isoforms, Ank1.5-Ank1.9, which range in molecular weight from approximately 17 to 24 kDa (108, 109). Unlike the larger canonical ankyrins, these small ankyrin isoforms lack the Nterminal ankyrin repeats and central spectrin-binding domain. Their C-terminal ends contain varying degrees of homology to the larger ankyrin isoforms (110, 111). Our laboratory has long been interested in isoform Ank1.5, commonly referred to as small ankyrin 1 (sAnk1). Here I focus on a novel role for sAnk1 in regulation of SERCA1 activity (see chapter 2). Initially, however, sAnk1 was identified as providing a critical link between the SR and the underlying contractile apparatus (see below). D. Small Ankyrin 1 (sAnk1) Small ankyrin 1 (sAnk1) was first identified as a protein of 20 to 26 kDa which distribute in a reticular pattern within the myoplasm of both rat and rabbit skeletal muscle. It is encoded by the terminal 4 exons (exons 39-42) of the human ANK1 gene (see above), located at chromosomal position 8p11.1. Alternative splicing of the transcript leads to additional sAnk1 isoforms and may account for the multiple bands of different apparent molecular weights found on immunoblots. Interestingly, western blots show not only are multiple bands observed within a single muscle tissue, but bands of slightly varying molecular weight are observed within the same muscle of different species. The most abundant of these sAnk1 isoforms in SR preparations from rabbit 14
skeletal muscle is comprised of 155 amino-acid residues, with a predicted molecular mass of 17.5 kDa and molecular mass of ~22 kDa as determined in SDS-PAGE. At its C-terminus, sAnk1 shares significant sequence homology with other Ank1 isoforms (Fig. 1.5). The N-terminus of sAnk1 is composed of 72 unique amino acids residues; the first 29 of which are highly hydrophobic and serve to localize and anchor sAnk1 to the SR membrane in muscle and the ER membrane in HEK293 or COS7 cells (Fig. 1.5;(91, 109)). Porter et al. further demonstrated that these 29 N-terminal residues could sufficiently target proteins to the M-band and Z-disk in skeletal muscle fibers by creating a chimeric protein of sAnk1 (1-29) and Β-galactosidase. Another interesting feature of sAnk1 is in its ability to form homodimers, and potentially higher order homooligomers (e.g. tetramers) through disulfide linkages. This was observed in both isolated SR vesicles (91), and COS7 cells (see chapter 5), and is thought to be mediated through juxtamembrane residues C26 and C34. The C-terminus of sAnk1 has been well established as a ligand of the giant muscle proteins, titin and obscurin (110, 112-119). Here I discuss a novel role for the transmembrane (TM) portion of sAnk1 and its ability to mediate an interaction with SERCA1 (see chapter 2). Following the discovery of sAnk1, our laboratory focused on determining binding partners of sAnk1 using a yeast two-hybrid screen. Using the cytoplasmic portion of sAnk1 as bait, the ~800 kDa protein obscurin (specifically, obscurin A; (120)) was identified as a ligand of sAnk1 (116). Through a combination of yeast two-hybrid, blotoverlay and GST pull down assays, it was demonstrated that sAnk1’s cytoplasmic domain specifically bound to the C-terminal region of obscurin, which could be localized by immunofluorescence studies of skeletal muscle at the level of Z-disks and M-bands
15
(116). These findings were supported by data from an independent group, although they identified a region of obscurin slightly N-terminal to the interaction site identified by Kontrogianni-Konstantopoulos et al., suggesting the possibility that two sAnk1 binding sites reside at the C-terminus of obscurin (118). Together, these studies were the first to suggest a protein is able to directly link the SR membrane to the proteins of the underlying contractile apparatus. The C-terminal portion of sAnk1 identified as the obscurin binding ligand contains two regions rich in positively charged residues. Site-directed mutagenesis showed that both of these regions are essential for high affinity binding between sAnk1 and obscurin (114). Molecular modeling suggested these regions are helical structures similar to ankyrin repeat domains, and so named ankyrin-like repeats. Further investigation into the regions of obscurin to which sAnk1 binds revealed that two distinct binding sites did exist. Site I, which encompasses obscurin residues 6316 to 6345, was found through Surface Plasmon Resonance (SPR) to bind sAnk1 with an affinity of 133 nM, while Site II (Obsc6231-6260) exhibited a lower affinity of 384 nM (113). The latter site corresponds to the site previously defined by Armani et al. (110). Another ligand of sAnk1 is the giant myofibrillar protein titin. Titin connects the Z-disk and M-band together within the sarcomere and contributes to the passive elasticity characteristic of muscle. Similar to the protein T-cap (telethonin), sAnk1 was found to bind the two most N-terminal Ig domains of titin found at the Z-disk (IgZ1/2; (117, 121)). Simultaneous binding of sAnk1 and T-cap to titin was also demonstrated through pulldown experiments using recombinant fusion proteins. This result suggested that these proteins may interact to form a three-way complex by which sAnk1 and T-cap link titin
16
to the SR membrane and t-tubules (117). It is important to note that compared to obscurin, the binding affinity between sAnk1 and titin is far weaker and is not observable using SPR. Additionally, another report found that sAnk1 was unable to bind the IgZ1/2 domains of titin (110). This contradiction may simply be due to different conditions used for each pull-down experiment. Importantly, it further suggests sAnk1’s affinity for binding titin is significantly less than its affinity for obscurin. Recently, the regulation of the turnover of the sAnk1 protein has been investigated. It was shown using an obscurin knockout mouse (Obscn-/-) that loss of obscurin led to disrupted subcellular localization of sAnk1 in addition to reduced protein levels (122). When analyzed in immunoblots, sAnk1 often shows a laddering pattern indicative of post-translational modifications such as ubiquitination. To determine the type of modifications occurring, sAnk1 was co-expressed with GFP-tagged ubiquitin, sumo1, sumo2, or nedd8. They observed modification by ubiquitin and nedd8, but not by sumo1 or sumo2 (122). Later, it was shown that sAnk1 is subject to acetylation in addition to ubiquitination and neddylation (123). This study showed that acetylation promotes the interaction between sAnk1 and KCTD6, which decreased sAnk1’s susceptibility to cullin-3 mediated ubiquitination and subsequent proteasomal degradation. Interestingly, these results suggest that neddylation was not associated with increased sAnk1 turnover (123). Rather neddylation may serve to occupy the lysine residues required for ubiquitin-mediated sAnk1 degradation. A sAnk1 knockout mouse has been created to determine if sAnk1 is required for the health of skeletal muscles. . Initial studies showed that loss of sAnk1 led to morphological and functional changes in the skeletal muscle. This effect was observed
17
only in old adult mice (12-15 months) and not young adult mice (4-6 months), and was most pronounced in the extensor digitorum longus (EDL) and diaphragm muscles (124). Interestingly, preliminary studies ongoing in our laboratory have shown that sAnk1 proteins levels are reduced in the skeletal muscle of aging wild-type mice compared to young mice of the same strain (see chapter 5). Another study used siRNA to knock down sAnk1 expression in mouse myofibers and showed similar disruption of SR morphology and functionality (125). This study showed sAnk1 knock down significantly disrupted SERCA1 localization and protein levels, and first suggested the potential for sAnk1 and SERCA1 to interact in skeletal muscle E. Network SR Integrity Depends on sAnk1 In order to study the role of sAnk1 in skeletal muscle, Ackermann and colleagues used siRNA targeted to the 5’ untranslated region (UTR) of sAnk1’s mRNA in order to knock down its expression (125). The reduced sAnk1 protein levels were accompanied by decreased levels of SERCA1 and SLN protein. mRNA levels of both SERCA1 and SLN were not altered. The localization of nSR proteins SERCA and SLN were significantly disrupted when sAnk1 was absent, in contrast to proteins of the triad junction and sarcomere, which were only moderately effected, if at all. In some cases the knock down of sAnk1 was only partial. Colocalization analysis between residual sAnk1 and SERCA1 was shown to be reduced by a factor of 2 compared to controls. Interestingly, the level of colocalization between the residual sAnk1 and SLN was unchanged at low sAnk1 levels. Rescue of SERCA1 and SLN localization was observed when sAnk1 was reintroduced into the muscle fibers. Consistent with these results, myofibers depleted of sAnk1 had reduced Ca2+ uptake kinetics and lumenal SR Ca2+ 18
stores. Ackermann et al. speculate that based on these data, sAnk1 may interact with either SERCA or SLN. This prompted us to examine this possibility more closely in this thesis F. Research Significance and Goals All eukaryotic cells must maintain Ca2+ homeostasis in order to remain viable and functional. Disruption of Ca2+ homeostasis has been linked to several human diseases, including heart disease and muscular dystrophy. Therefore, the mechanisms which regulate intracellular Ca2+ ([Ca2+]i)are extensively researched. By pumping Ca2+ from the cytosol back into the ER or SR lumen, SERCA plays a major role in maintaining low [Ca2+]i. SERCA’s importance is exemplified by the ubiquitous expression of its various isoforms, and its link to human disease when expression or function is compromised (29, 126). Brody’s and Darier’s disease are two human genetic conditions caused by mutations in SERCA1 and SERCA2, respectively (126). Other studies have implicated SERCA in various types of cancer, including colon cancer, lung cancer, head and neck squamous cell carcinoma and liver tumors linked to hepatitis B virus (126-129). Reduction in SERCA activity levels has also been documented in muscular dystrophies (130, 131). In skeletal muscle, elevated [Ca2+]i can contribute to the dystrophic phenotype by activation of Ca2+ dependent proteases (e.g. calpain) and lead to necrosis through inducing mitochondrial permeability transition pore formation (132135). A 2011 study examined the idea that Ca2+ was a “final common pathway” for the muscular degeneration observed in muscular dystrophies. It showed that overexpression of SERCA1 in muscle was able to improve the phenotype in three separate dystrophic mouse models, suggesting that reduction of intracellular Ca2+ alone may be a viable 19
therapeutic strategy (136). Furthermore, reduced SERCA functionality is described in nearly all models of heart failure (137-140). Consistent with this, mutations in the SERCA regulator, PLN, have been linked to dilated cardiomyopathies in humans. As heart disease is the leading cause of death in the United States, accounting for approximately 1 in every 4 deaths according to a 2015 update from the CDC (http://www.cdc.gov/heartdisease/facts.htm), the importance of understanding causative mechanisms is paramount. The broad spectrum of diseases associated with SERCA dysregulation or dysfunction make it an appealing system to study and manipulate. As previously mentioned, gene therapy to overexpress SERCA1 or SERCA2 may be able to treat muscular dystrophies and cardiomyopathies, respectively. Additionally, recent studies investigating the mechanism by which SLN promotes SERCA mediated thermogenesis in mice have huge implications for fighting obesity (79). While PLN and SLN are well known regulators of SERCA, there is still much to understand about how they coordinately function to modulate SERCA activity. Of course, the discovery of additional proteins that regulate SERCA increases the complexity of this system, making translational studies potentially more difficult. The goal of the current study was to investigate the possibility, raised by the discovery of Ackermann et al. (see above), that sAnk1 interacts directly with SERCA1. In Chapter 2, I show that this is indeed the case, and that the interaction, like that between SERCA1 and SLN, is mediated at in part by TM interactions as hypothesized. We further demonstrate that separate cytoplasmic contacts also contribute to sAnk1’s ability to interact with SERCA1. Additionally, chapter 2 reports on the effects of sAnk1 on
20
SERCA1 activity. In Chapter 3, I document the interactions between sAnk1 and SLN and the effects of SLN on the interactions between SERCA1 and sAnk1. In Chapter 4, I present evidence consistent with a possible role of sAnk1 in the muscular dystrophy seen in the mdx mouse and in the loss of muscle function associated with aging in mice. My results reveal a new mechanism of SERCA1 regulation that is essential for muscle health.
21
Table 1.1. The ATP2A Family of Genes Description of the ATP2A gene family. These three genes encode the various SERCA isoforms. Indicated ate their chromosomal location in both human and mouse.
22
Figure 1.1. Skeletal Muscle Structure A muscle fiber is a single multinucleated cell made up of many myofibrils. Each myofibril is surrounded by a membranous network known as the sarcoplasmic reticulum. The repeating unit of each myofibril is known as a sarcomere which is organized into the thick (myosin) and thin (actin) filaments, and give the muscle its striated appearance. The thin filaments make up I band region which is bisected by the Z-disk and the thin filaments make up the A band region which is bisected by the M line. The bottom section shows a close up image of a sarcomere obtained using electron microscopy. This image has been adapted from Lehninger Principles of Biochemistry Fifth Edition by Michael M. Cox and David L. Nelson, 2008.
23
Figure 1.2. The Membrane Systems of a Skeletal Muscle Fiber.
A skeletal muscle fiber contains two highly specialized membrane systems. Invaginations of the surrounding plasma membrane (sarcolemma) run through each myofiber to create the transverse tubules (t-tubules). A second internal membrane system called the sarcoplasmic reticulum (SR) stores the calcium required for muscle contraction. The SR consists of the junctional SR or terminal cisternae, and the network SR. The junctional SR and t-tubles form structures called triads, and together work to regulate calcium release. The network SR is responsible for the reuptake of calcium following muscle contraction. This image has been adapted from http://completesoccertraining.blogspot.com/2012/05/functional-anatomy-of-skeletalmuscle.html 24
25
Figure 1.3. Domains of SERCA SERCA1a shown in its Ca2+-bound state (E1Ca2). The Ca2+-ATPase consists of 10 transmembrane spanning helices which comprise the 2 Ca2+ binding sites located within the transmembrane region. The cytoplasmic portion of SERCA1a consists of three distinct domains: the actuator (A) domain, the phosphorylation (P) domain, and the nucleotide binding (N) domain. These domains coordinate the binding and hydrolysis of ATP required for transporting Ca2+ from the cytoplasm to the SR lumen. This image has been adapted from Green, N. M., MacLennan, D.H. Structural biology: calcium calisthenics. Nature. 418, 598-599 (2002).
26
Figure 1.4. SERCA Reaction Cycle The E1 and E2 states represent SERCA in its high and low Ca2+ affinity conformations, respectively. Starting from the top left: Two Ca2+ ions bind sequentially followed by ATP binding and enzyme phosphorylation at D351. Release of ATP stimulates the E1 to E2 conformational change and translocation of Ca2+. SERCA dephosphorylation occurs via nucleophilic attack of a water molecule on the aspartylphosphate intermediate. This figure has been adapted from reference(65).
27
Figure 1.5. Small Ankyrin and Comparative Sequence Alignment A. Schematic representation of the sAnk1 (Ank1.5) protein. sAnk1 has a unique Nterminal domain which is composed of 73 amino acids. The first 29 amino acids comprise the transmembrane domain. The 82 C-terminal amino acids of sAnk1 are conserved with the larger canonical ankyrin isoforms. B. Sequence alignment of the Cterminal 100 amino acid residues of human Ank1.5 and several other ankyrin isoforms shows significant sequence conservation.
28
29
Chapter II. Identification of sAnk1 as a Novel SERCA1 Regulatory Protein in Skeletal Muscle1 A. Abstract Small Ankyrin 1 (sAnk1) is a 17 kDa transmembrane (TM) protein that binds to the cytoskeletal protein, obscurin, and stabilizes the network sarcoplasmic reticulum (nSR) in skeletal muscle. We report that sAnk1 shares homology in its TM amino acid sequence with sarcolipin, a small protein inhibitor of the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA). Here we investigate whether sAnk1 and SERCA1 interact. Our results indicate that sAnk1 interacts specifically with SERCA1 in SR vesicles isolated from rabbit skeletal muscle, and in COS7 cells transfected to express these proteins. This interaction was demonstrated by co-immunoprecipitation (coIP) and an anisotropy-based FRET method (AFRET). Binding was reduced approximately two-fold by the replacement of all the TM amino acids of sAnk1 with leucines by mutagenesis. This suggests that, like sarcolipin, sAnk1 interacts with SERCA1 at least in part via its TM domain. Binding of the cytoplasmic domain of sAnk1 to SERCA1 was also detected in vitro. ATPase activity assays show that co-expression of sAnk1 with SERCA1 leads to a reduction of SERCA1’s apparent Ca2+ affinity, but that sAnk1’s effect is less than that of sarcolipin. The sAnk1 TM mutant has no effect on SERCA1 activity. Our results suggest that sAnk1 interacts with SERCA1 through its TM and cytoplasmic domains to regulate SERCA1 activity and modulate sequestration of Ca2+ in the SR lumen. The identification of sAnk1 as a novel regulator of SERCA1 has significant implications for
1
Patrick Desmond, Joaquin Muriel, Michele Markwardt, Mark Rizzo, Robert Bloch. As submitted to the Journal of Biological Chemistry. 2015.
30
muscle physiology and the development of therapeutic approaches to treat heart failure and muscular dystrophies linked to Ca2+ misregulation. B. Introduction The mechanisms that regulate calcium homeostasis are critical to the function and viability of eukaryotic cells. In muscle, maintaining low resting intracellular Ca2+ ([Ca2+]i < 100 nM) compared to that found extracellularly (~2 mM) or within the lumen of the sarcoplasmic reticulum (SR; free, ~0.4 mM, total ~2 mM (19-22), is critical to excitation-contraction coupling (126). The sarco(endo)plasmic reticulum calcium ATPase (SERCA) is the enzyme that pumps Ca2+ from the cytoplasm into the lumen of the SR, leading to muscle relaxation following contraction. In mammals, there are three ATP2A genes that encode more than 10 different SERCA isoforms (29). The ubiquitous expression of one or more SERCA isoforms highlights its importance in the Ca2+ dynamics of muscle and non-muscle cells alike. Alterations in SERCA expression and activity are linked to several forms of muscular dystrophy and cardiomyopathies, including heart failure (126, 141-144). In addition, age-related alterations in SERCA levels have been observed in both animal models of aging and senescent human myocardium, suggesting changes in SERCA activity may also be relevant to the aging process (29). The small transmembrane (TM) proteins, phospholamban (PLN) and sarcolipin (SLN), are the two most well-known regulators of SERCA activity. PLN is expressed at high levels in the ventricles of the heart and at lower levels in the atria and in slow-twitch skeletal muscle (45-47). SLN expression is more prominent in the atria and in fast-twitch skeletal muscle of larger mammals (44, 48, 50, 144-146). SLN and PLN share extensive
31
homology in their TM sequences (48, 56, 88), which mediate their binding to several of the TM helices of SERCA (51, 55, 147-151). The TM sequences also mediate homo- and hetero-oligomerization of PLN and SLN (54, 82, 87-89, 152-155). SLN and PLN also interact with SERCA via their lumenal and cytoplasmic sequences, respectively (52, 84, 156). The binding of PLN or SLN to SERCA is associated with a reduction in SERCA’s apparent Ca2+ affinity (57), and both proteins together have been reported to have a synergistic effect, leading to super-inhibition of SERCA, presumably through forming a ternary complex (51, 54). Recent studies demonstrate that PLN and SLN can be co-expressed in both human and rodent skeletal muscle tissue, suggesting that superinhibition of SERCA activity may play a significant role in the regulation of intracellular Ca2+ (83, 84). Another small SR protein, myoregulin (MLN), which like SLN interacts with SERCA1 and inhibits its activity, has also been recently reported (41). Small ankyrin 1 (sAnk1, also known as Ank1.5), an alternatively spliced product of the ANK1 gene, is a 155 amino acid TM protein (109, 110, 157). The 82 C-terminal cytoplasmic residues share homology with the larger members of the ankyrin superfamily, while the 73 N-terminal residues are unique to sAnk1 and include a TM domain in its most N-terminal sequence (91, 110, 158). sAnk1 localizes to the network compartment of the SR (nSR) (91, 110, 114, 116-118, 125, 159) and colocalizes with SERCA1 in the nSR surrounding Z-disks (109, 125). The C-terminus of sAnk1 protrudes into the cytoplasm (91) where it can interact with the giant myofibrillar proteins, obscurin and titin (115-117). These interactions provide a potential connection between the nSR
32
membrane and the underlying contractile apparatus, and are thought help to organize the SR membrane around each sarcomere (116, 122, 160). In a 2011 study, Ackermann et al. examined the effects of reducing the expression of sAnk1 in mouse myofibers using siRNA targeted to the 5’ UTR of its mRNA (125). Decreases in sAnk1 mRNA and protein levels were accompanied by a reduction in both SERCA and SLN protein (but not mRNA) levels. Consistent with these results, Ca2+ uptake kinetics and lumenal SR Ca2+ stores were reduced in myofibers depleted of sAnk1 (125). Reintroducing sAnk1 by transfection rescued SERCA localization. Remarkably, the loss of sAnk1 significantly disrupted SERCA and SLN localization within the nSR but had much smaller effects on proteins of the triad junction and sarcomere (125). More recently, Giacomello et al. showed that muscle cells lacking sAnk1 due to homologous recombination have a compartment that was both reduced in size and slower to take up Ca2+ (124). These observations suggested that sAnk1 may play a broader role than initially believed in the organization and stabilization of the nSR. One possibility that we considered is that sAnk1 can interact directly with SERCA and that in its absence the nSR membrane either does not form or is unstable if it does. Here we test this hypothesis in experiments to examine the interactions between sAnk1 and SERCA. C. Experimental Procedures Materials— The chemiluminescence kit used for immunoblotting was from Applied Biosystems (Foster City, CA). Thapsagargin (TG), A23187, and ATP were from Sigma Chemical Co. (St. Louis, MO). Dynabeads coupled with sheep anti-mouse IgG or sheep anti-rabbit IgG and Lipofectamine were from Invitrogen (Carlsbad, CA). Pi 33
ColorLock ALS reagents were from Novus Biologicals (Littleton, CO).
Amylose resin
was from New England Bioloabs (Ipswich, MA). All buffers were supplemented with Complete Protease Inhibitor Cocktail Tables (Roche; Indianapolis, IN). Antibodies—Primary antibodies against sAnk1 were made by injecting rabbits with the C-terminal sequence of sAnk1 (C-Ahx-VKRASLKRGKQ-OH)3 linked to BSA. Antibody generation and affinity purification was carried out by 21st Century Biochemicals, Inc. (Marlborough, MA). Other primary antibodies used include: SERCA1 (IIH11 mAb), Ryanodine receptor-1 (RyR1) (34C mAb), and triadin (GE 4.90 mAb) from Thermo Scientific (Waltham, MA); Junctophilin-1 (JPH1) (ab57425 mAb) from abcam (Cambridge, MA); JPH1 (40-5100 rabbit pAb) from Invitrogen; FLAG (M2 mAb and rabbit pAb, Sigma; mCherry (rabbit pAb, Biovision (Milpitas, CA)); MBP (E8302 mAb); mouse IgG1κ (MOPC-21, Sigma); rabbit IgG (Jackson ImmunoResearch (West Grove, PA)); and SLN (rabbit pAb, Proteintech Group (Chicago, IL)). cDNA construction—Rabbit cDNAs encoding SERCA1 and an N-terminal FLAG-tagged sarcolipin (NF-SLN) in the pMT2 vector were gifts from Dr. David MacLennan (University of Toronto). SERCA1 cDNA was extracted by digestion with EcoRI, and inserted into the pCDNA3.1 (-) vector. A C-terminal FLAG-tagged sAnk1 was generated by digesting sAnk1 cDNA from the pmCherry-N1 vector constructed previously (114) with EcoRI and BamHI, and ligating it into p3xFLAG-CMV-14. Sense (5’CCGATCATGGAGCGATCCACCCGGGAGCTGTGTCTCAACTTCACTGTTGTC CTTATTACAGTGATCCTTATTTGGCTCCTTGTGAGGTCCTACCAGTACTGAG3’) and antisense (5’AATTCTCAGTACTGGTAGGACCTCACAAGGAGCCAAATAAGGATCACTGT
34
AATAAGGACAACAGTGAAGTTGAGACACAGCTCCCGGGTGGATCGCTCCATG ATCGGAGCT3’) oligomers of the rabbit SLN coding region were synthesized with SacI (5’) and EcoRI (3’) overhanging restriction sites (Integrated DNA Technologies, Coralville, IA) and hybridized. The hybridized SLN oligomer, as well as cDNAs encoding SERCA1 (5’ SacI, 3’ EcoRI), sAnk1 (5’ KpnI, 3’ EcoRI) and dysferlin (5’ KpnI, 3’ BclI) were all inserted into the pmCerulean3-C1 (CFP) and pmVenus-C1 (YFP) vectors. Construction of the mCerulean3: mVenus conjugate has been described (161, 162). Transfection— COS7 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin in an atmosphere of 10% CO2/90% air and transiently transfected with cDNA at a concentration of 1 μg/mL and either Lipofectamine 2000 (Invitrogen) or LipoD293 (SignaGen, Gaithersburg, MD), according to manufacturer’s protocols. When two cDNAs were transfected together, we used a ratio of 1:2 (SERCA1 cDNA: X, where X was sAnk1 or SLN cDNA). Cells were seeded to achieve ~70-80% confluency at time of transfection, and incubated for 48h to allow protein expression. Cells seeded on 35 cm tissue culture plates with glass bottoms (MatTek, Ashland, MA) were washed with Hank’s balanced salt solution + 0.1% bovine serum albumin and used for anisotropybased fluorescence resonance energy transfer (AFRET). Cells in 10 cm tissue culture dishes were washed twice with PBS, detached with a cell scraper, homogenized and subjected either to differential centrifugation (163) to obtain a microsomal fraction for ATPase measurements, or subjected to centrifugation at 12,000 x g and solubilized in a solution containing 0.5% Tween-20 (see below) for co-immunoprecipitation studies.
35
Co-immunoprecipitation—CoIP experiments were performed as described in (164), with preparations of SR vesicles isolated by the method of Eletr and Inesi (165, 166) from rabbit skeletal muscle from the back and hind limb (Pel-Freez, Rogers, AR), or from crude membrane extracts of COS7 cells prepared as described (163, 167). For the latter, COS7 cells were harvested in PBS at 48h following transfection, collected by centrifugation, frozen in liquid N2 and stored at -80°C until needed. Briefly, pellets were homogenized with 30 strokes of a glass Dounce homogenizer in resuspension buffer (0.25 M sucrose, 10 mM Tris-HCl, pH 7.5, 20 mM CaCl2, 3 mM 2-mercaptoethanol, 150 mM KCl), and solubilized with an equal volume of lysis buffer (40 mM HEPES-NaOH, pH 7.5, 300 mM NaCl, 2 mM EDTA, 1% Tween 20). SR vesicles were prepared for coIP by the same methods for resuspension and solubilization. The muscle and cell extracts were pre-cleared with 50 µL uncoated Dynabeads. The pre-cleared extracts were mixed with antibody-coated Dynabeads (5ug antibody/50uL beads) and incubated at 4oC for 4h. Following ≥ 5 washes in washing buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% Tween 20), protein was eluted by boiling the beads in 70 µL SDSPAGE sample loading buffer. Proteins in the samples were separated by SDS-PAGE and analyzed via immunoblot as described (168). Microscopy— Cultures of COS7 cells transfected as described above were fixed in PBS containing 4% paraformaldehyde and 4% sucrose for 15min at room temperature and mounted in Vectashield (Vector Laboratories, Burlingame, CA). Confocal microscopy used a Zeiss 510 META system (Carl Zeiss, Thornwood, NY) equipped with a 63X, 1.4 numerical aperture objective lens. Images were collected by exciting the samples at 458 nm (CFP) and 514 nm (YFP), provided by an argon laser, and collected
36
through 480-520 nm (CFP) and 530-600 nm (YFP) BP filters. Co-localization was assessed by Pearson’s coefficients with ImageJ software (http://rsb.info.nih.gov/ij/index.html), and the Just Another Co-localization Plugin (169). To study the interaction between SERCA1 and sAnk1 by AFRET, transfected COS7 cells on cover slips were washed with HBSS + 0.1% BSA without phenol red and examined with a specially equipped Zeiss AxioObserver microscope (170) with a 20X, 0.75 numerical aperture dry objective lens. Details of the filters used to collect emissions and equations used to analyze the data have been described (170, 171). Briefly, fields were illuminated with vertically polarized light and the intensity of emitted light was measured in planes parallel (V) and perpendicular (H) to that used for illumination. Emissions were collected for donor, acceptor, and FRET (excite donor, collect acceptor) fluorescence in both planes. Image J software was used to stack and align the images (16-bit) and to collect mean intensity values from a minimum of 3 regions of interest (ROI) per cell. ROIs were excluded if their mean pixel intensity value was < 2000 above background. Microsoft Excel was used to calculate anisotropies and FRET, indicated by a non-zero difference between the anisotropy measured for the FRET channel compared to the anisotropy measured for the donor (Δr = rCFP – rFRET). The many advantages of AFRET over other FRET methods have been discussed (161, 172). Blot overlay assay— The blot overlay assay was performed as described (116, 173) with minor modifications. Aliquots containing 10 µg of SR vesicle protein, purified as described above, were separated on 4-12% SDS-PAGE gels and transferred to PVDF membranes. Blots were placed in overlay buffer (50 mM Tris, pH 7.5, 120 mM NaCl, 3% BSA, 2mM dithiothreitol, 0.5% NP-40, 0.1% Tween-20) for 4h at 25°C and then
37
incubated with 3 µg/mL MBP or sAnk1 (29-155)-MBP in overlay buffer for 12h at 4°C. The generation and purification of these fusion proteins were as described (117). A separate section of the membrane was reserved to identify SERCA1. Blots were washed extensively with overlay buffer and once with TBS, pH 7.4, plus 0.5% Tween-20 (TBST). The blots were blocked in TBST + 4% non-fat dry milk for 4h at 25°C and probed with antibodies to MBP (overlay portion) and SERCA1 (non-overlay portion). Immunoblots were completed as described above. MBP pull down assay— Maltose Binding Protein (MBP) and sAnk1 (29-155)MBP fusion protein (20 µg) were bound to 50 µL of amylose resin in MBP column buffer (20 mM Tris-HCl, 200 mM NaCl, 1mM EDTA). Resin was washed extensively with column buffer and once with IP lysis buffer (see above) and then mixed with 250 µg protein from COS7 cell lysates transfected to express SERCA1 (see above), and incubated for 12h at 4°C. After the amylose resin was washed extensively in IP buffer, bound proteins were eluted by boiling in 50 µL SDS-PAGE sample loading buffer and analyzed via SDS-PAGE and immunoblotting methods (168). Assay of Ca2+-ATPase activity—ATPase activity was measured in microsomes prepared as described (163) from transfected COS7 cells with a colorimetric assay to detect inorganic phosphate (Pi) released during ATP hydrolysis. Microsomal vesicles (20 μg/ml) were incubated in assay buffer (20 mM MOPS, pH 7.0, 100 mM KCl, 5 mM NaN3, 5 mM MgCl2, 1 mM EGTA, 2.5 mM ATP, 2 μM ionophore A23187) . Reactions were initiated by addition of different amounts of CaCl2 to achieve desired [Ca2+free], as calculated by Maxchelator webware (http://maxchelator.stanford.edu/webmaxc/webmaxclite115.html). Following a 30min
38
incubation at 37°C, reactions were loaded in triplicate onto 96 well plates and terminated by addition of Pi ColorLock ALS reagent to detect Pi. Absorbance was read 30min later at 635 nm on a Tecan Infinite M1000 Pro spectrophotometer. Immunoblots were used to measure levels of SERCA1 in each experimental group. Densitometric analysis with ImageJ quantified the relative expression levels of SERCA1 in the different cell preparations to normalize the measured ATPase activity. Activity values are reported as percentage of the maximum level of activity when SERCA1 was expressed alone. Transmembrane modeling and protein docking—The TM region of sAnk1 and SLN were modeled with I-TASSER (174) and the sequences of the human proteins. ClusPro version 2.0 was used for automated protein docking simulation (175-178). The sAnk1 TM model obtained from I-TASSER was docked to the crystal structure of SERCA1 (4H1W). Models were visualized and annotated with DeepView, the SwissPdbViewer version 4.10 (179). Statistics—Values are reported as mean ± SE. Each data point for AFRET experiments represents the average Δr value from all valid ROIs (see Microscopy for criteria). T-tests compared these values to a theoretical mean of zero to determine if the mean AFRET value was statistically significant. Student’s t-test’s were used to compare sAnk1 (WT) and (all-L) for coIP and AFRET experiments with p < 0.05 being considered significant. Results of assays of ATPase activity were fit to the equation for an allosteric sigmoidal model (Y=Vmax*[S]h/(Kprime + [S]h): (77, 180).) from data acquired in 4 experiments conducted on microsomes from 3 independent transfections. KCa2+ ([Ca2+]free resulting in half-maximal activation) was calculated using nonlinear regression analysis. All graphs were produced with GraphPad Prism 5 software (La
39
Jolla, CA). Statistics were evaluated with one-way ANOVA with p < 0.05 being considered significant. Protein accession numbers— The NCBI accession numbers for the proteins studied here are: SERCA1 (Rabbit-NP_001082787), sAnk1 (Human-NP_065211.2; Mouse-NP_001264213; Rat-Not available), SLN (Human-NP_003054; MouseNP_079816; Rat-NP_001013265), PLN (Mouse-NP_001135399), MLN (MouseNP_001291668). D. Results The TM domain of sAnk1 shares sequence similarity with SLN— The observation that sAnk1 colocalizes with SERCA1 and is required for the structural integrity of the nSR suggested a possible interaction between sAnk1 and SERCA1. SLN is the major regulator of SERCA1 activity in skeletal muscle, and it is known to associate with SERCA through transmembrane (TM) interactions (55). For these reasons, we compared the TM amino acid sequences of sAnk1 and SLN. As sAnk1 and SLN are oriented in opposite directions within the SR membrane (Fig. 1a), we aligned the two sequences accordingly (Fig. 1b). The TM domains of these proteins were 29% identical and 53% conserved, for an overall similarity of 82% (Fig. 1c). We also found that sAnk1 shared considerable sequence similarity with PLN (76%), and to a lesser extent with MLN (47%, Fig 1d). To determine the significance of the sequence similarity between sAnk1 and SLN, we searched a database comprised of 13,607 TM sequences for the identical residues shared between sAnk1 and SLN (181). We found that 0.75% of sequences in this database contain the sequence TVLL or its reverse, LLVT, suggesting that the sequence 40
similarity is significant. We also used the values of Senes et al. (181) for the frequency at which each amino acid occurs at a particular position in TM sequences, to calculate the chances of the 17-FXXXXXTVLL-8 sequence occurring randomly. This probability was 80%, with 29% and 24% sequence identity, respectively. Our analyses reveal that these similarities are highly significant. As SLN interacts with SERCA via its TM domain (55), we predicted that sAnk1 would do so, too. Co-immunoprecipitation experiments showed that sAnk1 and SERCA1 associated specifically in SR vesicles isolated from rabbit muscle and in membrane fractions from transfected COS7 cells. Similarly, AFRET experiments in COS7 cells co-expressing pairs of CFP and YFP fusion proteins showed energy transfer from SERCA1-CFP to sAnk1-YFP. This suggests that these proteins reside within 10 nm of one another in living cells (187) and are likely to interact directly. Furthermore, Ca2+ATPase assays showed that co-expression of sAnk1-FLAG and SERCA1 significantly reduced SERCA1’s apparent Ca2+ affinity. Together, these data support our hypothesis that sAnk1 is able to interact with SERCA1 to regulate its activity similar to SLN. Moreover, our experiments showing that the cytoplasmic domain of sAnk1 binds to SERCA1 in blot overlay experiments, indicate that the association of sAnk1 with SERCA1 is direct and not mediated by other proteins. We used a combination of coIP, AFRET and ATPase assays to elucidate the role of sAnk1’s TM domain in its ability to bind to SERCA1 and inhibit its activity. We
49
found that the TM domain of sAnk1 is important in mediating its interaction with SERCA1. sAnk1 (all-L) and SERCA1 were found to coIP together only ~50% as efficiently as WT sAnk1 and SERCA1. Similarly, AFRET analysis revealed a decrease in the Δrmean between SERCA1-CFP and sAnk1 (all-L)-YFP compared to WT. The reduced interaction between SERCA1 and sAnk1 (all-L) suggests that sAnk1 may dock to SERCA1 in the same pocket, comprised of several of SERCA1’s TM helices, used by SLN and PLN. We speculate that the binding that persists between SERCA1 and sAnk1 (all-L) is due to sAnk1’s cytoplasmic domain. The most interesting effect of mutating sAnk1’s TM domain was the inability of the mutant to shift SERCA’s apparent Ca2+ affinity. This observation suggests that specific amino acids within the TM region of WT sAnk1 are important for its inhibitory function. Recently, structural modeling was used to analyze the similarities between the alpha-helical TM region of SLN and myoregulin (MLN), another small protein of the SR membrane that can inhibit SERCA (41). We used the same software to compare the TM regions of sAnk1 and SLN and found that several of the conserved TM residues of sAnk1 shared similar spatial orientations with several identical and conserved residues of SLN (Fig. 8a). In agreement with our hypothesis and our experimental observations, automated docking simulations predicted that the TM region of sAnk1 binds the same region of SERCA as SLN (Fig. 8b). Closer examination of the predicted docking site of sAnk1 shows amino acid sidechains protruding into the binding pocket where SLN binds SERCA1 (55). When compared to a published crystal structure of the SERCA1-SLN complex, it is clear that several of these residues are shared between sAnk1 and SLN
50
(Fig. 8c). These models are consistent with sAnk1 binding to SERCA1 in the same pocket as SLN, PLN and MLN to modulate SERCA activity. The changes in binding and the ability of sAnk1 to inhibit SERCA1 activity when the TM domain is mutated to all leucines is particularly interesting considering the similarity between sAnk1 WT and sAnk1 (all-L). WT sAnk1’s TM domain contains 6 leucine residues, and 8 of the 11 remaining TM residues are hydrophobic. Therefore only 3 of the TM amino acid residues between positions 4 and 20 represent non-conservative mutations. The 3 hydrophilic residues within the TM domain are Thr6, Glu7 and Thr11. We speculate that these residues may contribute to sAnk1’s ability to inhibit SERCA1 activity, but we recognize that several specific hydrophobic residues may also play a role in modulating SERCA activity, as with SLN and PLN (51, 56, 164, 188, 189), including V10 and L8 residues, which are conserved between sAnk1 and SLN. Future studies to determine the specific TM residues necessary for sAnk1 to exhibit its inhibitory effect will therefore be important. In addition to TM contacts, cytoplasmic and lumenal interactions are significant for PLN and SLN to regulate SERCA, respectively (52). It was shown recently that mutation or deletion of the C-terminal residues of PLN led to improper localization and impaired regulatory activity (185). Similarly, the highly conserved C-terminus of SLN is important for SLN function. Gorski et al. showed that the lumenal tail of SLN (RSYQY) was required for SLN to inhibit SERCA1 activity maximally, and that a truncated SLN mutant lacking the 4 C-terminal amino acid residues inhibited SERCA1 activity less effectively than full-length SLN (84, 156). These data are in agreement with earlier mutagenic studies that identified Y29, Q30, and Y31 as residues important for SLN’s
51
inhibitory effect (56). The significance of SLN’s lumenal tail was further indicated with a chimeric PLN mutant which had these residues from SLN added to its C-terminus. This chimeric protein was super-inhibitory, and may help to explain the differences observed in the relative abilities of sAnk1 and SLN to inhibit SERCA1 activity (84). Future studies using chimeric variants of sAnk1 can address this possibility. As a significant portion of the sAnk1 polypeptide extends into the cytosol (91), we sought to determine if like PLN and SLN, sAnk1 could interact with SERCA1 independently of the TM domain. This was addressed using the cytoplasmic domain of sAnk1 (residues 29-155) in coIP, pull down, and blot overlay assays. The results show that the cytoplasmic domain of sAnk1 is also able to interact with SERCA1, although less efficiently than full length sAnk1. This would be consistent with a model in which sAnk1-SERCA1 interactions are mediated by a combination of interactions occurring in the TM and cytoplasmic domains of both proteins. More extensive structural analyses and mutagenesis studies are under way to test this idea. Although sAnk1 interacts directly with SERCA1, it is not clear how, or even if, this interaction helps to stabilize or regulate the function of the nSR in muscle. Short term incubation of myofibers with siRNA to reduce sAnk1 expression and elimination of sAnk1 completely by homologous recombination both lead to loss of the nSR and associated reductions in the rate of Ca2+ clearance from the myoplasm (124, 125), Decreased levels of sAnk1 should increase SERCA1 activity, leading to increased rates of Ca2+ clearance, but the effects of any such increase may be overridden by the loss of the nSR itself. They may also be altered by changes in other proteins, such as SLN, that regulate SERCA activity but that may also interact with sAnk1 and the sAnk1-SERCA1
52
complex. These interactions may influence the stability of the nSR membrane either directly, through altered membrane curvature or changes in protein-protein or proteinlipid binding, or indirectly, through changes in the handling of Ca2+. Alternatively, the ability of sAnk1 to bind to cytoskeletal proteins, including obscurin (110, 114, 116, 159), may influence the stability of the nSR. It will be of considerable interest to learn whether or not sAnk1’s cytoplasmic domain can bind obscurin and SERCA1 simultaneously. Alterations in expression and activity of SERCA in skeletal and cardiac muscle are linked to several forms of muscular dystrophy and cardiomyopathies, including heart failure (126, 141-144). In addition, age-related alterations in SERCA levels have been observed in both animal models and senescent human myocardium, suggesting that it may be relevant to the aging process (29). SERCA activity has also been shown to play a critical role in the pathogenesis of Alzheimer’s disease, exemplifying the broad implications of understanding SERCA regulation (39, 190, 191) and the significance of discovering potential targets for manipulating SERCA activity. Here we have demonstrated that sAnk1 is able to interact with SERCA1 in skeletal muscle in a way much like SLN. Furthermore, this interaction results in SERCA1 inhibition, as measured by a reduction in SERCA1’s apparent Ca2+ affinity. The possibility that the expression of sAnk1 is not limited to striated muscle suggests that it may play a more universal role as a regulator of SERCA activity in other tissues. Coexpression of sAnk1 with either SLN, PLN, or MLN in various tissues also suggests a more intricate level of co-regulation by multiple micropeptides and small proteins. Future studies will aim to determine if sAnk1 can interact with SLN and super-inhibit SERCA activity.
53
Table 2.1. ATPase Assays Shown is a summary of the compiled results of all ATPase assays presented in Figure 2.6. The KCa2+ ([Ca2+] required for half-maximal activation) is given in pCa2+ units (right-hand column) and nanomolar concentration (left-hand column). The change in KCa2+ (ΔKCa2+) relative to control (SERCA1 Alone) is given in pCa2+ units. Results are mean values ± SE.
54
Figure 2.1. Sequence comparison in transmembrane regions of sAnk1 and SLN A. Relative orientation of sAnk1 and SLN within the SR membrane. B. Residues that are identical or conserved in sAnk1 and SLN are highlighted in dark and light gray, respectively. C. Percent similarity between sAnk1 and SLN. D. Mouse amino acid sequence comparison of the transmembrane region of sAnk1, SLN, PLN and MLN. Similar residues are highlighted in gray.
55
56
Figure 2.2. CoIP of SERCA and sAnk1 from rabbit skeletal muscle. A. SR vesicles were solubilized and subjected to IP with antibodies to SERCA1 or sAnk1. B. Specificity was demonstrated with an antibody to junctophilin-1 (JPH1), which co-immunoprecipitated RyR1 and TRDN but not SERCA1 or sAnk1. Nonimmune rabbit or mouse IgG were used as controls and did not immunoprecipitate either SERCA1 or sAnk1. The results show that SERCA1 and sAnk1 coIP specifically from solubilized SR vesicles.
57
Figure 2.3. CoIP of SERCA and sAnk1 from COS7 cells. A. Extracts of COS7 cells transfected as indicated below were subjected to IP with antibodies to SERCA1, sAnk1, or mCherry. Non-immune rabbit or mouse IgG was used as controls. The results show that SERCA1 and WT sAnk1 coIP specifically in COS7 cells, consistent with the results from muscle tissue. B. Compared to sAnk1 (WT), expression of sAnk1 (all-L) with SERCA1 led to a significant reduction in coIP between the two proteins. C & D. Quantitative comparison showed that coIP was reduced by ~50% for the mutant sAnk1 when normalized to coIP of SERCA1 and sAnk1 (WT). Reduction in coIP between SERCA1 and sAnk1 (all-L) ranged between 34 and 61%. This result was statistically significant by t-test (C, p = 0.0024 and D, p = 0.0033). Note: bands observed in IP lanes above mCherry protein (A) and above and below sAnk1(WT)mCh are non-specific bands due to the presence of the subunits of the antibodies used for IP. 58
59
Figure 2.4. Colocalization of fluorescent fusion proteins in COS7 cells. A-C. COS7 cells were transfected with cDNA encoding the indicated fluorescent fusion proteins. Significant colocalization was observed when SERCA1-CFP was co-expressed with SLN-YFP, sAnk1-YFP and sAnk1 (all-L)-YFP, and when SERCA1-CFP or sAnk1CFP was co-expressed with dysferlin-YFP (see merged panels A3, B3 and C3, respectively), as measured by Pearson’s correlation coefficient. The values of the Pearson’s coefficient is included at the bottom of the merged image for each pair of proteins studied ( > 0.7 for each). Scale bar = 10 µm. 60
61
Figure 2.5. AFRET of sAnk1 and SERCA and SLN and SERCA in COS7 cells. A. COS7 cells were transfected with SERCA-CFP together with either sAnk1-YFP, sAnk1 (all-L)-YFP, SLN-YFP, or dysferlin-YFP. SERCA-CFP alone was used as a control. One day post-transfection, AFRET was measured and expressed as Δr (rCFPrFRET). Each point represents the average AFRET for a single cell. T-tests for each sample set were performed against a theoretical mean of zero; * indicates that the mean is statistically greater than zero (p < 0.0001). Results show energy transfer between sAnk1 and SERCA1, and SLN and SERCA1, but not between SERCA1 and dysferlin, sAnk1 and dysferlin, or SERCA1 alone. B. When compared to sAnk1 via t-test (WT), sAnk1 (all-L) showed a significant reduction in Δr, suggesting reduced binding due to the mutated TM domain (***, p = 0.0008).
62
63
Figure 2.6. Ca2+- ATPase assay in COS7 microsomes. A. COS7 cells were transfected with the indicated cDNA construct(s). ATPase activity was determined at each [Ca2+] free compared to the Vmax measured for SERCA1 alone, following normalization of the levels of SERCA1 expression as determined by immunoblotting (see Experimental Procedures). Data were fitted to the equation for a general cooperative model for substrate binding. Results show that co-expression of sAnk1 with SERCA leads to a reduction of SERCA’s apparent affinity for Ca2+, but that the effect of sAnk1 is less than that of SLN. B. The KCa ([Ca2+] free required for halfmaximal activation) values were determined from each curve. Mean KCa: SERCA1 pCa = 6.33 (468 nM), SERCA1 + sAnk1 pCa = 6.15 (708 nM), SERCA1 + SLN pCa = 5.95 (1122 nM). C. Unlike sAnk1 (WT), sAnk1 (all-L) did not significantly alter the affinity of SERCA1 for Ca2+. D. Mean KCa: SERCA1 pCa = 6.31 (488 nM), SERCA1 + sAnk1 pCa = 6.10 (794 nM), SERCA1 + sAnk1 (all-L) pCa = 6.30 (502 nM). Statistics used 1 way ANOVA: *, p < .05 vs SERCA1, **, p < .01 vs SERCA1 and #, p < .05 vs SERCA1+sAnk1 (all-L).
64
65
Figure 2.7. The cytoplasmic domain of sAnk1 directly interacts with SERCA1 in vitro. A. top: Extracts of COS7 cells transfected to express SERCA1 and WT sAnk1-FLAG were subjected to IP with antibodies to SERCA1 or FLAG. Non-immune mouse or rabbit IgG were used as controls. The results show that SERCA1 and sAnk1-FLAG specifically interact in COS7 cells, and that the epitope tag on sAnk1 does not alter this interaction. bottom: COS7 extracts were co-transfected to express SERCA1 and FLAGtagged versions of full length sAnk1 or the cytoplasmic domain, sAnk129-155.. A FLAG empty vector was used as controls. The results indicate that, like FLAG-tagged full length sAnk1 (sAnk1 WT), a FLAG-tagged form of the cytoplasmic domain of sAnk1 (sAnk129-155) also coIPs with SERCA1. B. Amylose resin bound to bacterially expressed sAnk129-155-MBP fusion protein was incubated with COS7 extracts transfected to express SERCA1. MBP protein alone was used as a control. Densitometric analysis of the eluates after SDS-PAGE and blotting with antibodies to SERCA1 revealed a 9-fold increase in the amount of SERCA1 pulled down by sAnk129-155 relative to the MBP control (bottom panel). Ponceau staining was used as a loading control (top panel). C. SR vesicle preparations were used for blot overlay assays. Blots were first overlaid with sAnk129-155-MBP or MBP protein alone, followed by incubation with antibodies to MBP. The labeled band at ~110 kDa (left panel) indicates that sAnk1(29-155)-MBP, but not MBP protein alone, can bind to SERCA1 directly. Ponceau staining was used as a loading control (right panel). 66
67
Figure 2.8. Modeling the sAnk1 TM domain. A. The TM domains of SLN (top) and sAnk1 (bottom) were modeled with I-TASSER webware. The results show that 5 side chains in the TM α-helix of sAnk1 occupy very similar positions along the helix as their counterparts in the TM domain of SLN (highlighted in green). B. ClusPro 2.0 webware was used to determine the predicted docking site of sAnk1 to SERCA1. Comparison of this model to the published crystal structure of rabbit SERCA1a docked to SLN was performed with PyMOL 1.3. The results show that sAnk1 is predicted to dock to SERCA1 in a similar, but not identical, position to SLN. C. Backbone helices of SERCA and sAnk1 are shown in white. SERCA residues highlighted in magenta and red are reported to be important for SLNmediated SERCA inhibition. Similar residues shared between sAnk1 and SLN are highlighted in green. The docking model shows that the sAnk1 residues which extend into the TM binding pocket of SERCA1 are positioned similarly to those of SLN. Orientation is from inside the SR lumen, looking down into the cytoplasm.
68
69
Chapter III. Interactions between Small Ankyrin 1 and Sarcolipin Coordinately Modulate Activity of the Sarco(endo)plasmic Reticulum Ca2+-ATPase (SERCA1)2 A. Abstract We recently reported that small ankyrin 1 (sAnk1) interacts with sarco(endo)plasmic reticulum Ca2+-ATPase in skeletal muscle (SERCA1) to inhibit its activity. This interaction was shown to occur at least in part through its transmembrane domain in a manner similar to sarcolipin (SLN). Earlier studies have shown that SLN and phospholamban (PLN), the other small SERCA regulatory protein, are able to oligomerize either alone or together. As sAnk1 is co-expressed with SLN in muscle, we studied if these proteins interact with one another when co-expressed exogenously in COS7 cells. Interaction was demonstrated using co-immunoprecipitation and anisotropybased FRET method (AFRET) assays. We found that sAnk1 and SLN can associate in the SR membrane and after exogenous expression in COS7 cells in vitro by coIP and AFRET analysis. Significantly, SLN promoted the interaction between sAnk1 and SERCA when the three proteins were co-expressed. Ca2+-ATPase assays showed that sAnk1 reduced the ability of SLN to inhibit SERCA1 activity. These data suggest that sAnk1 interacts with SLN either directly, or in complex with SERCA1, and results in a reduction in SLN’s inhibitory effect on SERCA1 activity. B. Introduction The sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA1) facilitates relaxation of skeletal muscle by pumping Ca2+ ions from the cytoplasm into the lumen of the
2
Patrick Desmond, Joaquin Muriel, Michele Markwardt, Mark Rizzo, Robert Bloch. In preparation for submission.
70
sarcoplasmic reticulum (SR; (29, 57)). Its function is important to maintain cellular calcium homeostasis and proper excitation-contraction coupling. As several human diseases related to improper calcium handling have been linked to alterations in SERCA expression or activity, the mechanisms regulating SERCA are of great interest (29, 126, 142-144). Much research has been performed to characterize the TM proteins phospholamban (PLN) and its homologue sarcolipin (SLN) and their ability to inhibit the activity of SERCA (44, 49, 57). Recently a third micropeptide, termed myoregulin (MLN), has also been shown to interact with SERCA and to inhibit its activity in mouse skeletal muscle (41). All of these SERCA regulatory proteins interact with SERCA at least in part through TM interactions that lead to a reduction in SERCA’s apparent Ca2+ affinity. We have recently reported that another small protein can modulate SERCA. The protein, : small ankyrin 1 (Ank1.5, sAnk1), is a 17 kDa transmembrane (TM) protein of the network SR (nSR) in skeletal muscle that, like PLN, SLN and MLN, interacts with SERCA1 at least in part via its TM domain to decrease its apparent Ca2+ affinity (192). Encoded by the ANK1 gene, sAnk1 is member of the ankyrin superfamily and is composed of 155 amino acids (a.a.). It has a unique N-terminus (a.a. 1-73) which includes a TM domain (a.a. 1-19) that anchors it within the membrane of the network sarcoplasmic reticulum (nSR; (108-110, 157). The remainder of the protein is exposed in the cytoplasm and includes the last 82 a.a. that share homology to the larger ankyrin isoforms (92, 125), Previous studies have shown that sAnk1 concentrates in the membrane at the level of the M-band and Z-disk, where its C-terminus is thought to interact with the myofibrillar proteins obscurin and titin, respectively (116, 117). These interactions are hypothesized to maintain a link between the SR membrane and the 71
underlying proteins of the contractile apparatus. Later studies revealed that elimination of sAnk1 by homologous recombination reduced SR function (124), and that short term reduction of sAnk1 expression by siRNA resulted in disruption of the nSR (125). Reducing sAnk1 expression with siRNA also was accompanied by a decrease of the levels of SERCA1 and SLN proteins and inhibited Ca2+ clearance from the myoplasm (125). These results were among the first to suggest sAnk1 could interact with SERCA1 and SLN. We recently reported that sAnk1 interacts directly with SERCA1 in a manner similar to, but distinct from, SLN. Similarities between sAnk1 and SLN include their TM a.a. sequence and their shared ability to homodimerize (91). Also like SLN, we found that sAnk1 binding to SERCA1 leads to a similar reduction in SERCA1’s apparent Ca2+ affinity, and that mutation of the sAnk1 TM domain eliminated its ability to modulate SERCA1 activity. Intriguingly, the studies of sAnk1 knock down by Ackermann et al. showed that the residual sAnk1 showed reduced colocalization with SERCA1 while its co-localization with SLN was unaffected (125). Based on this observation, and the ability of SLN and PLN to form homo-oligomers and hetero-oligomers interactions, we asked if sAnk1 could interact with SLN alone or in a three way complex with SERCA1. As both sAnk1 and SLN are co-expressed together in skeletal muscle, we hypothesize that the two proteins together may affect SERCA activity differently than either protein alone (91, 109), as previously shown for SLN and PLN (51, 54). Here, we investigate whether sAnk1 and SLN interact with one another, and how their co-expression with SERCA1 alters these interactions and ability to regulate SERCA1 activity.
72
C. Experimental Procedures Materials— The chemiluminescence kit used for immunoblotting was from Applied Biosystems (Foster City, CA). ATP, A23187, and Thapsagargin (TG) were from Sigma Chemical Co. (St. Louis, MO). Lipofectamine and Dynabeads coupled with sheep anti-rabbit IgG or sheep anti-mouse IgG were from Invitrogen (Carlsbad, CA). The Pi ColorLock ALS reagent was from Novus Biologicals (Littleton, CO). Buffers were supplemented with Complete Protease Inhibitor Cocktail Tables from Roche (Indianapolis, IN). Antibodies— Primary antibodies against SLN were made by injecting rabbits with the C-terminal sequence of SLN (acetyl-LVRSYQYC-amide and C-Ahx-LVRSYQYOH) linked to BSA. Antibody generation and affinity purification was carried out by 21st Century Biochemicals, Inc. (Marlborough, MA). Primary antibodies against sAnk1 were generated as previously described (192). Other antibodies used include: SERCA1 (IIH11 mAb); FLAG (M2 mAb and rabbit pAb, Sigma; mouse IgG1κ (MOPC-21, Sigma); rabbit IgG (Jackson ImmunoResearch (West Grove, PA)); and SLN (rabbit pAb, Proteintech Group (Chicago, IL)). cDNA construction—Constructs encoding SERCA1-pCDNA3.1, CFP-SERCA1, YFP-SERCA1, YFP-SLN, FLAG-SLN, sAnk1-FLAG, CFP-sAnk1, YFP-sAnk1 and YFP-dysferlin were generated as previously described (192). Transfection— COS7 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin in an atmosphere of 10% CO2/90% air and transiently transfected with cDNA at a concentration of 1 μg/mL and either Lipofectamine 2000 (Invitrogen) or
73
LipoD293 (SignaGen, Gaithersburg, MD), according to manufacturer’s protocols. Cotransfection of two or more cDNAs were carried out using a ratio of 1:2:2 (SERCA1 cDNA: X: Y) unless otherwise indicated. Cells were seeded to achieve ~70-80% confluency at time of transfection, and incubated for 48h to allow protein expression. Cells seeded on 35 cm tissue culture plates with glass bottoms (MatTek, Ashland, MA) were washed with Hank’s balanced salt solution + 0.1% bovine serum albumin and used for AFRET. Cells in 10 of 15 cm tissue culture dishes were washed twice with PBS, detached with a cell scraper, homogenized and subjected either to differential centrifugation (163) to obtain a microsomal fraction for ATPase measurements, or subjected to centrifugation at 12,000 x g and solubilized in a solution containing 0.5% Tween-20 (see below) for co-immunoprecipitation studies. Co-immunoprecipitation (CoIP)—CoIP experiments were performed as described (164), with preparations of SR vesicles isolated by the method of Eletr and Inesi (165, 166) from rabbit skeletal muscle from the back and hind limb (Pel-Freez, Rogers, AR), or crude membrane extracts of COS7 cells prepared as described (163, 167). COS7 cells were harvested in PBS at 48h following transfection, collected by centrifugation, and processed for use or frozen in liquid N2 and stored at -80°C until needed. Briefly, pellets were homogenized using 30 strokes of a glass Dounce homogenizer in resuspension buffer (0.25 M sucrose, 10 mM Tris-HCl, pH 7.5, 20 mM CaCl2, 3 mM 2mercaptoethanol, 150 mM KCl), and solubilized with an equal volume of lysis buffer (40 mM HEPES-NaOH, pH 7.5, 300 mM NaCl, 2 mM EDTA, 1% Tween 20). SR vesicles were prepared for coIP by the same methods for resuspension and solubilization. Extracts were mixed with antibody-coated Dynabeads (1 µg antibody/10 µL beads) and
74
incubated at 4oC for 4h. Following ≥ 5 washes in washing buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% Tween 20), protein was eluted by boiling the beads in 70 µL SDS-PAGE sample loading buffer. Proteins in the samples were separated by SDS-PAGE and analyzed via immunoblot as described (168). Microscopy— Cultures of COS7 cells, transfected as described above, were fixed in PBS containing 4% paraformaldehyde and 4% sucrose for 15 min at room temperature and mounted in Vectashield (Vector Laboratories, Burlingame, CA). Confocal microscopy used a Zeiss 510 META system (Carl Zeiss, Thornwood, NY) equipped with a 63X, 1.4 numerical aperture objective lens. Images were collected by exciting the samples at 458 nm (CFP), 514 nm (YFP), and 543 nm (DS-Red and mCherry), provided by an argon laser, and collected through 480-520 nm (CFP), 530-600 nm (YFP) BP and 560 nm (DS-Red and mCherry) LP filters. Co-localization was assessed by Pearson’s coefficients with ImageJ software (http://rsb.info.nih.gov/ij/index.html), and the Just Another Co-localization Plugin (169). For investigating the interaction between sAnk1, SERCA1, and SLN by AFRET, transfected COS7 cells on glass bottom plates were washed with HBSS + 0.1% BSA without phenol red and examined with a specially equipped Zeiss AxioObserver microscope (170) with a 20X, 0.75 numerical aperture dry objective lens. The filters used to collect emissions and equations used to analyze the data have been described in detail (170, 171). Briefly, fields were illuminated with vertically polarized light and the intensity of emitted light was measured in planes parallel (V) and perpendicular (H) to that used for illumination. Emissions were collected for donor, acceptor, and FRET (excite donor, collect acceptor) fluorescence in both planes. Image J software was used
75
to stack and align the images (16-bit) and to collect mean intensity values from a minimum of 3 regions of interest (ROI) per cell. ROIs were excluded if their mean pixel intensity value was < 2000 above background. Microsoft Excel was used to calculate anisotropies and FRET, indicated by a non-zero difference between the anisotropy measured for the FRET channel compared to the anisotropy measured for the donor (Δr = rCFP – rFRET). Assay of Ca2+-ATPase activity—ATPase activity was measured in microsomes, prepared from transfected COS7 cells as described (163), with a colorimetric assay to detect inorganic phosphate, Pi, released during ATP hydrolysis. Microsomal vesicles (20 μg/ml) were incubated in assay buffer (20 mM MOPS, pH 7.0, 100 mM KCl, 5 mM NaN3, 5 mM MgCl2, 1 mM EGTA, 2.5 mM ATP, 2 μM ionophore A23187) . Reactions were initiated by addition of different amounts of CaCl2 to achieve desired [Ca2+free], as calculated by Maxchelator webware. Samples were incubated at 37°C for 30 min before being loaded in triplicate onto 96 well plates and terminated by addition of Pi ColorLock ALS reagent to detect Pi. Following a 30 min incubation for color development, absorbance was read at 635 nm on a Tecan Infinite M1000 Pro spectrophotometer. The amounts of SERCA1 in the different experimental groups were determined by immunoblotting and densitometric analysis with ImageJ to normalize the measured ATPase activity. Activity values are reported as percentage of the maximum level of activity compared to SERCA1 alone. Statistics—The values reported here are mean ± SE. All graphs presented were created using GraphPad Prism 5 software (La Jolla, CA). For AFRET experiments, each data point represents the average Δr value from all valid ROIs (see Microscopy for
76
criteria). T-tests compared these values to a theoretical mean of zero to determine if the mean AFRET value was statistically significant. Student’s t-test’s was used to compare level of coIP of sAnk1 with or without SLN, with p < 0.05 being considered significant. Data for experiments examining titration of sAnk1 or SLN were fit using a linear regression. Significance was determined by a non-zero slope for which p < 0.05. Results of assays of ATPase activity were fit to the equation for an allosteric sigmoidal model (Y=Vmax*[S]h/(K’ + [S]h): (77, 180)) from data acquired in 4 experiments conducted on microsomes from 3 independent transfections. KCa2+ ([Ca2+]free resulting in half-maximal activation) was calculated using nonlinear regression analysis. Statistics were evaluated with one-way ANOVA with p < 0.05 being considered significant. D. Results Interaction of sAnk1 and SLN—Co-immunoprecipitation (coIP) was used to study the ability of sANk1 to interact with SLN in SR vesicles prepared from rabbit skeletal muscle tissue. When antibodies against sAnk1 were used to generate the immunoprecipitate, immunoblot analysis revealed coIP of SLN (Fig. 3.1a). This suggests that sAnk1 and SLN are able to interact to form a complex within the SR membrane. We next assessed the ability of sAnk1 and SLN to interact in an exogenous expression system. Using extracts from COS7 cells transfected to express the sAnk1-mCherry and FLAG-SLN fusion proteins showed similar results. Immunoblots of the IP generated using anti-FLAG showed sAnk1-mCherry was co-eluted with SLN (Fig. 3.1b), consistent with their interaction in SR vesicles. As a second method to investigate the interaction between sAnk1 and SLN we used an anisotropy-based fluorescence resonance energy transfer (AFRET) assay which 77
we previously used to demonstrate interaction between sAnk1 and SERCA1. Confocal microscopy was used to assess expression and localization of the fluorescent fusion proteins used for our AFRET studies. COS7 cells transfected to co-express sAnk1-CFP and SLN-YFP showed significant co-localization of the two fluorescent proteins to the endoplasmic reticulum (ER). Analysis with Pearson’s correlation coefficient showed a similar level of co-localization between sAnk1 and SLN, as we found with SERCA1 and sAnk1 or SLN in our previous study (Fig 2a; 0.74 ± 0.057; (192). ER localization was confirmed via co-transfection with the ER marker, DS-Red-KDEL (Fig. 3.2b). AFRET analysis was performed to determine if sAnk1 and SLN reside within 10 nm or less of one another. This method takes advantage of the intrinsically high anisotropy of fluorescent proteins (in contrast to small fluorescent molecules). A donor fluorophore excited with polarized light will have polarized emissions and high anisotropy values. Nearby acceptor molecules may accept photons outside the original plane of polarization via energy transfer, leading to a reduction in the measured anisotropy. This method also reduces the likelihood of false positives caused by overlapping spectra, and eliminates the need for other methods of FRET confirmation such as donor dequenching after acceptor photobleach. For more detail on this method and its advantages refer to (162, 170, 172). Results for the AFRET experiments in COS7 cells are shown in Figure 3.3. We found that energy transfer occurred in cells co-expressing sAnk1-CFP and SLN-YFP (Δrmean = 0.03 ± .006). This value was determined to be statistically significant when tested against a theoretical mean of zero (p = .0001). The AFRET value measured for sAnk1-CFP and SLN-YFP was in a range similar to that observed between SERCA-CFP
78
and SLN-YFP (Δrmean = 0.068 ± .007), and SERCA-CFP and sAnk1-YFP (Δrmean = 0.021 ± .005). In contrast, dysferlin, a protein of the transverse tubules in skeletal muscle, failed to show energy transfer with sAnk1 when it served as the acceptor fluorophore (not shown; (192)). The observed FRET between sAnk1 and SLN indicate these two proteins reside within the molecular distances of one another required for direct interaction. SLN promotes interaction of sAnk1 and SERCA1— The results presented above raised the question of how sAnk1 and SLN may alter the other’s ability to interact with SERCA1. To address this we first performed coIP experiments in COS7 cells transfected with SERCA1 and sAnk1-FLAG or FLAG-SLN, or with all three vectors. Interestingly, when compared to co-transfection of SERCA1 and sAnk1, the addition of FLAG-SLN led to a dramatic increase in the coIP of sAnk1 with SERCA1 (Fig. 3.4a). Upon quantitation, this increase was statistically significant (2.6-fold; p = 0.0047; Fig 3.4b). It is important to note that two bands (~5kDa and ~10kDa) are observed when immunoblotting for FLAG-SLN. This is likely due to SLN’s ability to form stable homodimers which persist even following boiling in the solutions containing SDS preparatory to SDS-PAGE (88). Further experiments demonstrated that, increasing the expression of FLAG-SLN by introducing more FLAG-SLN plasmid during the transfection step promoted coIP of sAnk1-FLAG with SERCA1 (Fig. 3.4c and e). The increase in coIP was linear with the amount of FLAG-SLN cDNA and was statistically significant, as determined via linear regression analysis (slope (m) = 0.67; p = 0.0018). We next performed the reciprocal experiment, in which sAnk1-FLAG was titrated, while SERCA1 and FLAG-SLN were kept constant. Unexpectedly, we saw no effect on increasing the amounts of plasmid encoding sAnk1-FLAG on coIP of FLAG-SLN with
79
SERCA1 (Fig. 3.4d). Linear regression analysis confirmed that sAnk1-FLAG did not alter coIP between SERCA1 and FLAG-SLN (m = 0.04, both bands; p = 0.046 upper band and 0.045 lower band; Fig. 3.4f). We previously showed that sAnk1 interacts with SERCA1 through both TM and cytoplasmic interactions by using a TM mutant of sAnk1 in which all the residues were changed to leucines, and by using a bacterially expressed protein containing the cytoplasmic portion of sAnk1 (sAnk (29-155)). Here we used the same cytoplasmic region of sAnk1 to determine if SLN had any effect on the cytoplasmic interaction between sAnk1 and SERCA1. Similar to its effect on the interaction between SERCA1 and full length sAnk1, the presence of FLAG-SLN enhanced the interaction between sAnk1(29-155) and SERCA1 2.7-fold (Fig 3.5). We also used AFRET to determine if FLAG-SLN enhanced the interaction between sAnk1 and SERCA1. Compared to the AFRET signal from COS7 cells transfected with SERCA-CFP and sAnk1-YFP, the signal from cells cotransfected with FLAG-SLN had an increased Δrmean (0.021 ± .005 vs. 0.036 ± .003; p = 0.04; Fig. 3.3). Thus, SLN promotes interaction between sAnk1 and SERCA1. sAnk1 reduces SLN mediated SERCA1 inhibition— We next compared the effects on SERCA1’s Ca-ATPase activity of sAnk1 and SLN expressed together, compared to either one alone. Our assays use microsomes prepared from COS7 or HEK293 cells and a colorimetric method to measure Pi release. Cells transfected with SERCA1 alone served as a control, and showed the highest level of Ca2+-dependent ATPase activity in both COS7 and HEK293 cells (pCa = 6.33 ± .016 and 6.38 ± .025, respectively). As reported previously, sAnk1-FLAG reduced SERCA1’s apparent Ca2+ affinity, measured in pCa
80
units, in COS7 and HEK293 cells (ΔKCa2+ = -0.18 and -0.21, pCa2+ units respectively; Fig. 3.6; Table 3.1). This shift was less than that produced by coexpression of FLAGSLN (ΔKCa2+ = -0.38 pCa2+ units in COS7 and -0.30 in HEK293; Fig. 3.6; Table 3.1). When sAnk1-FLAG and FLAG-SLN were coexpressed with SERCA1, the level of inhibition was less than that exhibited by FLAG-SLN alone (ΔKCa2+ = -0.21 in COS7 and -0.12 pCa2+ units in HEK293; Fig. 3.6; Table 3.1), and was statistically identical to that seen with sAnk1 and SERCA1. These findings suggest that sAnk1 reduces SLNmediated SERCA1 inhibition and may ablate it completely. E. Discussion sAnk1 and SLN share several features that suggest that they could interact in the membrane of the network SR and regulate SERCA1 activity in unique ways. First, their TM sequences are highly similar (192), and both proteins homo-oligomerize; SLN primarily through interactions of its TM domain (89, 91). SLN also heterooligomerizes with its homologue PLN, which too shares sequence similarity with sAnk1 (49, 192). Furthermore, sAnk1 and SLN colocalize in small membrane compartments that appear with the nSR fragments in response to knock down of sAnk1 expression, and their colocalization is greater than that seen between sAnk1 and SERCA1 (125). sAnk1, like SLN and PLN, interacts with SERCA1 to reduce its affinity for Ca2+ (43, 57), and, like SLN and PLN, it requires its TM domain for this inhibitory activity. Finally, SLN and PLN can combine to super inhibit SERCA1 activity, presumably by forming a complex containing all three proteins. These observations suggested an interaction between sAnk1 and SLN was probable, and that this interaction would alter SERCA1 activity in a distinct way. Here, we show that sAnk1 can indeed interact with SLN. When coexpressed with 81
SERCA1, SLN promotes interaction between sAnk1 and SERCA1. Surprisingly, sAnk1 suppresses SLN’s ability to inhibit the Ca2+-ATPase activity of SERCA1. As sAnk1 and SLN are coexpressed and colocalize with SERCA1 in the nSR, our results suggest that their interactions regulate Ca2+ homeostasis in skeletal muscle. We started investigating whether sAnk1 and SLN interact with one another using co-IP and AFRET experiments similar to those used for characterizing the interaction between SERCA1 and sAnk1. Co-IP revealed that sAnk1 and SLN were able to specifically associate in SR vesicles isolated from the back and hind limb of rabbit muscle, and in extracts of transfected COS7 cells. Using AFRET, we showed that sAnk1-CFP and SLN-YFP fusion proteins exhibited energy transfer, indicating the fluorescent proteins reside within 10 nm of one another and strongly suggests direct protein-protein interaction. Together, these data suggest that similar to SLN and PLN, SLN and sAnk1 are able to interact with one another as well. We next questioned how their interaction would affect eithers ability to interact with SERCA1, and how these two proteins may together affect SERCA1 activity. We addressed this using the same set of techniques, with COS7 cells transfected to express SERCA1, sAnk1-FLAG, and FLAG-SLN. Compared to cells expressing only SERCA1 and sAnk1, those containing all three proteins showed a significant increase in the level of coIP and energy transfer between sAnk1 and SERCA1. When coIP experiments were performed using increasing amounts of FLAG-SLN cDNA, sAnk1 in the pellet generated with antibodies to SERCA1 increased linearly with the expression of FLAG-SLN, suggesting that SLN promotes the association of sAnk1and SERCA1. Furthermore, we found that SLN was also able to promote the interaction between
82
SERCA1 and the cytoplasmic portion of sAnk1 (sAnk1 (29-155)). By contrast, the coIP of SLN with SERCA1 did not increase with increasing expression of sAnk1, suggesting that the effects of these two proteins on their association with SERCA1 are distinct. Together, these results suggest that SLN is able to promote the specific interaction between SERCA1 and, but the opposite does not hold true for sAnk1 altering the interaction between SLN and SERCA1. This result is especially interesting considering results shown by Asahi et al. in a series of publications in 2002 and 2003. They showed that coIP of SERCA1 with PLN was increased 3-fold when coexpressed with SLN (193). Further, coIP of SLN with SERCA1 was not changed by the presence of PLN. These results are strikingly similar to those I observe with SERCA1 and sAnk1. The authors do not, however, speculate as to how or why they observed such an effect (55, 193). Indeed, it remains unclear how SLN promotes the interaction between SERCA1 and sAnk1. One possible explanation is that SLN promotes a conformational change in one or more of SERCA1s domains. If the conformation of the SLN-bound Ca2+ pump opens a new site for sAnk1 to bind, this could explain the observed increase in co-IP and energy transfer. This possibility seems unlikely, however, as any effect of SLN on the apparent affinity of sAnk1 for SERCA1 should be reciprocal. If this is the mechanism by which SLN promotes sAnk1-SERCA1 binding, it would be not be explained by traditional allosteric theory. We are currently performing experiments with compounds, such as thapsigargin and Mg2+ with TNP-AMP, to stabilize SERCA1 in its E2 and the E1-Mg2+ conformation (which resembles the E1-2Ca2+ state), respectively (27, 194). As PLN and SLN prefer binding to SERCA1 in its E1-2Ca2+ state, Mg2+ and TNP-AMP may
83
promote sAnk1-SERCA1 binding similar to the level observed when SLN is present. Alternatively, oligomers of SLN could promote SERCA-sAnk1 interaction. Oligomers of SLN may interact with specific lipids to create extended rafts within the SR membrane in which SERCA1 and sAnk1 accumulate, increasing their local concentrations and thus their probability of interacting. Protein-lipid rafts have been described in the cell membrane (195) but to our knowledge have not been reported for intracellular membranes, including the SR. This explanation, however, is inconsistent with the observation that SLN promotes sAnk1’s cytoplasmic domain with SERCA1. The inability to determine the stoichiometry of these interactions makes it impossible to understand the exact reason for these observations at this time. While the exact dynamics between sAnk1, SLN and SERCA remain uncertain, it is clear that the three proteins coordinately regulate Ca2+ uptake. ATPase activity assays revealed that sAnk1 ablates SLN-mediated SERCA1 inhibition. Compared to the effect of SLN on SERCA1, the presence of sAnk1 prevents any additional shift in SERCA1’s apparent Ca2+ affinity. The effect of all three proteins on SERCA1 activity was statistically indistinguishable from the effect of sAnk1 alone. The observation that SERCA1’s activity in the presence of sAnk1 and SLN closely resembled that of sAnk1 is consistent with SLN promoting SERCA1-sAnk1 interaction. Future experiments aimed to determine how these three proteins interact will be important to elucidate the mechanism behind sAnk1’s ability to reduce SLN-mediated SERCA1 inhibition. Furthermore, it has been experimentally shown that levels of SLN and SERCA1 are altered in the mouse model of Duchenne’s muscular dystrophy (DMD; increased and
84
reduced, respectively; (196)). Therefore it will be of considerable interest to learn if the levels of sAnk1 are modified in ways that might contribute to pathogenesis.
85
Table 3.1. ATPase Assays Shown is a summary of the results from ATPase assays presented in Figure 3.6 for COS7 (A) and HEK293 (B) cells. The KCa2+ ([Ca2+] resulting in half-maximal activation) is given in pCa2+ units (right-hand column) and nanomolar concentration (left-hand column). The change in KCa2+ (ΔKCa2+) relative to control (SERCA1 Alone) is given in pCa2+ units. Results are mean values ± SE. The following indicate significant difference (P < 0.05) in mean pCa2+ as measured by one-way ANOVA: *Compared to SERCA1 Alone; #Compared to SERCA1 + SLN; $No significant difference. †Data previously shown (192).
86
87
Figure 3.1. CoIP of sAnk1 and SLN from rabbit skeletal muscle and COS7 cells. A. SR vesicles were solubilized and subjected to IP with antibodies to sAnk1. B. Extracts of COS7 cells transfected with sAnk1-mCherry and FLAG-SLN (NF-SLN) were subjected to IP with antibodies against mCherry. Non-immune rabbit IgG was used as a control. The results show that sAnk1 and SLN coIP in skeletal muscle extracts and COS7 cell lysates.
88
Figure 3.2. Colocalization of sAnk1 and SLN and sAnk1, SERCA1, and SLN in COS7 cells. A. COS7 cells were transfected with cDNAs encoding sAnk1-CFP and SLN-YFP. Significant colocalization was observed as measured by Pearson’s correlation coefficient (See bottom right of merged panel). B. Additionally, cotransfection of the indicated fluorescent fusion-proteins along with a DS-Red-KDEL marker revealed colocalization of these proteins to the ER. Similar results were observed when SERCA1-CFP, sAnk1YFP, and SLN-mCherry were coexpressed.
89
90
Figure 3.3. AFRET of sAnk1 and SLN in COS7 cells. A. COS7 cells were transfected with the donor-acceptor pairs (e.g. SERCA-CFP/SLNYFP) indicated below the panel. One day post-transfection, AFRET was measured and expressed as Δr (rCFP-rFRET). Each point represents the average AFRET for a single cell. T-tests for each sample set were performed against a theoretical mean of zero; * indicates that the mean is statistically greater than zero (p < 0.0001). The combinations of sAnk1 and SERCA1 and SLN and SERCA1 were used as a positive control. AFRET was observed between sAnk1-CFP and SLN-YFP. When FLAG-SLN was cotransfected with SERCA-CFP and sAnk1-YFP the average AFRET value was significantly increased as measured by T-test statistically analysis (#, p = 0.0401).
91
Figure 3.4. SLN promotes interaction between SERCA1 and sAnk1. A. COS7 cell extracts transfected as indicated below each panel were subjected to IP with antibodies specific to SERCA1. B. Quantitative densitometry analysis was performed to assess coIP between SERCA1 and sAnk1 in the presence or absence of FLAG-SLN. There was a 2.6-fold increase in coIP of sAnk1 when coexpressed with FLAG-SLN. C. Titration of FLAG-SLN as indicated below each panel reveals increased interaction between SERCA1 and sAnk1 with increasing expression of FLAG-SLN. D. Titration of sAnk1-FLAG has no effect on coIP between SERCA1 and FLAG-SLN. E and F. Graphical representation of densitometric analysis of experiments shown in C and D, respectively. Linear regression shows a significant increase in coIP of sAnk1 with SERCA1 with increasing SLN expression (panel E: m = 0.0672 ± 0.15; P = 0.0018; n=2), while increasing sAnk1 expression had no significant effect on coIP of SLN with SERCA1 ( panel F: m = 0.0404 ± 0.53; P = 0.5921 (upper band) and m = 0.3992 ± 0.05080; P = 0.6421 (lower band); n=2). Data represent slope ± S.E.M.
92
93
Figure 3.5. SLN promotes interaction between sAnk1’s cytoplasmic domain (sAnk29155)
and SERCA1.
Extracts of COS7 cells transfected with SERCA1 and sAnk1 (29-155)-FLAG in the presence or absence of FLAG-SLN (NF-SLN) were subjected to IP with antibodies against SERCA1. Non-immune mouse IgG was used as a control. The results show that the interaction between SERCA1 and the cytoplasmic domain of sAnk1 is increased in the presence of SLN.
94
Figure 3.6. Ca2+-ATPase assays. COS7 (A) and HEK293 (C) cells were transfected with the indicated cDNA construct(s). ATPase activity was determined at each [Ca2+]free compared to the Vmax measured for SERCA1 alone, following normalization of the levels of SERCA1 expression as determined by immunoblotting (see Experimental Procedures). Data were fitted to the equation for a general cooperative model for substrate binding. Results from both cell lines show that co-expression of sAnk1 with SERCA leads to a reduction of SERCA’s apparent affinity for Ca2+, but that the effect of sAnk1 is less than that of SLN as was previously shown (192). C and D. The KCa ([Ca2+] free required for half-maximal activation) values were determined from each curve and are summarized in Table 1a and b. COS7 mean KCa: SERCA1 pCa = 6.33 (468 nM), SERCA1 + sAnk1 pCa = 6.15 (708 nM), SERCA1 + SLN pCa = 5.95 (1122 nM), and SERCA1 + sAnk1 + SLN pCa = 6.12 (759 nM). HEK 293 mean KCa: SERCA1 pCa = 6.38 (415 nM), SERCA1 + sAnk1 pCa = 6.17 (680 nM), SERCA1 + SLN pCa = 6.08 (830 nM), and SERCA1 + sAnk1 + SLN pCa = 6.26 (560 nM). Statistics used 1 way ANOVA: *, p < .05 vs SERCA1, **, p < .01 vs SERCA1 and #, p < .05 vs SERCA1 + SLN.
95
96
Chapter IV. Small Ankyrin 1 levels are reduced in the mdx mouse model of Duchenne’s muscular dystrophy3 A. Abstract The coordinated release and re-uptake of calcium by the sarcoplasmic reticulum (SR) is essential for contraction and relaxation of striated muscle. Following Ca2+ release and muscle contraction, Ca2+ is pumped back into the SR by the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA), leading to muscle relaxation. Altered expression or activity of SERCA is linked to cardiomyopathy and muscular dystrophy. We have recently identified a novel protein regulator of SERCA1, called small ankyrin 1 (sAnk1; 17kDa), that inhibits its activity similar to the action of sarcolipin (SLN). Previous studies have shown that protein levels of SERCA1 and SLN are significantly altered in the mdx mouse model of Duchenne’s muscular dystrophy (DMD). Here we examine the changes of sAnk1 relative to SERCA1 and SLN in two murine models of muscular dystrophy. Immunoblot analysis confirmed earlier results that protein levels of SERCA1 are reduced in skeletal muscles of mdx mice, while those of SLN increase. sAnk1 levels were also significantly reduced in mdx skeletal muscle tissue. These changes were not observed in the dysferlinopathic BlaJ mouse model of muscular dystrophy. Our results suggest that alterations in SERCA1, SLN and sAnk1 may contribute to the aberrant cytosolic [Ca2+] levels associated with progression of DMD in the mdx background, and that these changes are disease-specific.
3
Patrick Desmond, Alyssa Collier, Sankeerth Manne, Robert Bloch. In preparation for submission.
97
B. Introduction Muscular dystrophies (MD) are genetic disorders characterized by progressive muscular atrophy and in most cases premature death (197). The most common form of MD is Duchenne muscular dystrophy (DMD). This X-linked disease is caused by a mutation in the dystrophin gene (198, 199) which leads to reduced synthesis or production of non-functional dystrophin protein. Dystrophin is an integral component of the dystrophin-glycoprotein complex (DGC), which links the cytoskeleton to the extracellular matrix in striated muscle. The DGC transmits some of the force generated through contraction laterally across the sarcolemma to the matrix, stabilizes the sarcolemma during the changes in muscle length associated with contraction and relaxation, and also harbors signaling domains that contribute to the regulation of muscle homeostasis (200). The absence of dystrophin or other proteins in the DGC renders muscles susceptible to contraction-induced damage (200). While the loss of sarcolemmal integrity is likely responsible for the primary onset of DMD (201), long-term increases in the concentration of in intracellular Ca2+ ([Ca2+]i) plays a large role in disease severity (136, 196, 202-206). Increases in [Ca2+]i can activate of Ca2+-dependent proteases and opening of the mitochondrial transition pore, leading to aberrant protein degradation and necrosis, respectively (133, 134, 205, 207). Although the precise mechanism of the increased [Ca2+]i associated with DMD are unclear, it is believed to occur via increased Ca2+ entry through the sarcolemma and by the impaired functioning of SR Ca2+ handling proteins (131, 202, 204, 208-215), including enhanced leak of Ca2+ through the ryanodine receptor and altered expression or function of the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA(130, 131, 202, 204,
98
216-219). Recent studies have found that SERCA1 expression is reduced in mouse models of DMD (mdx and mdx/Utr-/-) and suggested that upregulation of the SERCA inhibitor, SLN, may contribute to alter Ca2+ handling in dystrophic muscle (196). Other studies have shown that upregulation of SERCA1 can ameliorate symptoms in both the mdx and mdx/Utr-/- dystrophic mouse models, and protect against contraction-induced injury (220-222). Together these results suggest that targeting SERCA expression or function may be beneficial in treatments of DMD. We have recently identified a new regulator of SERCA called small ankyrin 1 (sAnk; Ank1.5). sAnk1 is an integral membrane protein which confers stability to the network sarcoplasmic reticulum (nSR), in part through its interactions with the cytoskeletal proteins obscurin and titin. Our recent studies have shown that sAnk1 also interacts with sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA1) and SLN to modulate SERCA1 activity. In particular, sAnk1 inhibits SERCA1 activity but reduces the level of inhibition exerted by SLN (192). Here we investigate whether, like SERCA and SLN, the level of expression of sAnk1 is altered in striated muscle of mouse models of DMD (mdx) and Limb Girdle Muscular Dystrophy2B/Miyoshi Myopathy (BlaJ). Our results indicate that mdx muscles show reduced expression sAnk1, as well as an increase in SLN and decrease in SERCA1 levels, but that these changes are not observed in the muscle of BlaJ mice. Thus, changes in sAnk1 could exacerbate the changes in SERCA1’s ability to sequester Ca2+, and may be specifically relevant in Duchenne’s muscular dystrophy.
99
C. Experimental Procedures Animals— Animals were 2 month old C57BL/10ScSnJ control and mdx mice, and 3 month old C57BL.6 control and dysferlin-null BlaJ (B6.A-Dysfprmd/GeneJ) mice, all from the Jackson Laboratories (Bar Harbor, ME) or bred in our facilities. All protocols were approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine and in accordance with guidelines of the NIH. Materials— The chemiluminescence kit used for immunoblotting was from Applied Biosystems (Foster City, CA). Homogenization buffer was purchased from Sigma Chemical Co. (St. Louis, MO) and was supplemented with Complete protease inhibitors (Roche, Indianapolis, IN). Antibodies— Primary antibodies against SLN were made by injecting rabbits with the C-terminal sequence of SLN (acetyl-LVRSYQYC-amide and C-Ahx-LVRSYQYOH) linked to BSA. Antibody generation and affinity purification was carried out by 21st Century Biochemicals, Inc. (Marlborough, MA) Primary antibodies against sAnk1 were generated as previously described (my paper) Other antibodies used include: SERCA1 (IIH11 mAb) and GAPDH (71.1 mAb) from Sigma . Immunoblotting— Tissues extracted from mice were processed immediately or flash frozen in liquid N2 and stored at -80ºC until time of use. Muscles were homogenized with a TissueLyser (Qiagen Hilden, Germany) in ice cold RIPA (RadioImmunoprecipitation Assay) buffer (150 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris, pH 8.0), at 10 µL buffer/mg tissue. Homogenates were subjected to centrifugation at 4ºC for 15 min at 10,000 g and supernatants were collected. Samples were diluted 1:1 with SDS-PAGE buffer (Bio-Rad,
100
Hercules, CA) and boiled at 100ºC for 5 min. Aliquots containing 15 µg total protein was separated by SDS-PAGE on 10% Bis-Tris gels (Invitrogen) and transferred to PVDF membranes. Membranes were incubated with Tris-buffered saline + 5mM sodium azide + 0.5% Tween-20 (TBST) and 4% dry milk and probed with antibodies against SERCA1 (1:2,500), GAPDH (1:20,000), sAnk1 (2 µg/mL), and SLN (2 µg/mL) overnight at room temperature (RT). Antibodies were removed and the membrane was washed in TBST + 4% dry milk for 3 x 10 min at room temperature. Blots were probed with secondary antibodies conjugated to alkaline phosphatase from Jackson ImmunoResearch (West Grove, PA) and washed with TBST (3 x 10 min, RT). Blots were developed by chemiluminescence as described (168). D. Results Altered expression level of Ca2+ handling proteins in skeletal muscles of the mdx mouse — Previously, it has been published that levels of SERCA1 are reduced and SLN are elevated in skeletal muscle tissues of mdx mice (196), which are a commonly used murine model of DMD. We have recently shown that SERCA1 is regulated by the protein sAnk1, and that sAnk1 can interact with SLN to modulate its effect on the function of SERCA1. We therefore determined if, like SERCA1 and SLN, the expression of sAnk1 protein is modified in mdx muscle tissue. We used 12 week old mdx or C57BL/6ScSnJ (control) mice to assess relative levels of SERCA1, sAnk1, and SLN in the tibialis anterior (TA), gastrocnemius, quadriceps, soleus, extensor digitorum longus (EDL) muscles, and in the heart via immunoblotting (Fig. 4.1 A-F). GAPDH was used as a loading control. Consistent with previous results (196), SERCA1 levels in mdx tissue were significantly reduced in all
101
skeletal muscles except soleus, where no significant change occurred (Fig. 4.2 A). We did not study SERCA1 in heart, as the major cardiac isoform is SERCA2 (29). The levels of SLN were also significantly upregulated in all the mdx skeletal muscle tissues we examined, including soleus (Fig. 4.2 B). In some cases (e.g. quadriceps muscle) SLN levels were elevated over 5 times that found in controls (Figure 4.2 B; Table 4.1). The sole exception occurred in the heart, which showed a small yet statistically significant reduction in SLN expression. Immunoblots of murine muscle extracts for sAnk1 showed distinct bands at ~17 kDa and ~25kDa (Fig. 4.1), with the lower molecular weight band being more prominent. Normalized to GAPDH levels, the amount the ~17 kDa sAnk1 band was significantly reduced in all tissues examined from mdx mice except for the soleus and EDL (Fig. 4.2 C). The reduction in the ~25kDa sAnk1 band was more dramatic, and was statistically significant in all tissues other than soleus (Fig. 4.2 B). Both sAnk1 bands were also significantly reduced in heart muscle. A full summary of the quantitative immunoblot analysis is shown in Table 4.1. We also assessed the levels of these proteins in a dysferlinopathic mouse model (BlaJ). We found that in the quadriceps of BlaJ mice, there were no significant differences in the levels of SERCA1, sAnk1, or SLN (Fig. 4.3a and 4.3b). This suggests that Ca2+ dysregulation associated with changes in the expression of SERCA1, SLN and sAnk1 can vary with the form of MD E. Discussion Research on muscular dystrophies, and specifically DMD, has dramatically improved the treatments available to those suffering from these devastating disorders. 102
There has been much progress in the field leading to several new clinical trials (198), however much remains unclear about the physiological changes associated with this disease. One of the factors believed to contribute significantly to the pathological progression of DMD is the elevated level of intracellular Ca2+. In skeletal muscle, SERCA is the primary enzyme responsible for regulation of intracellular Ca2+ by transporting Ca2+ from the cytosol to the SR. Previous studies have shown the expression levels of SERCA and its regulator SLN are altered in two dystrophic mouse models. Together with our recent discovery of a new modulator of SERCA activity, sAnk1, led us to ask if sAnk1 expression is altered in the mdx mouse model of DMD. Our findings here are the first to show alterations in sAnk1 protein expression level in an animal model of a disease. We found that the levels of SERCA, SLN and sAnk1 in several skeletal muscle tissues were altered in mdx muscle compared to that observed in control mice via western blot analysis. Our results confirmed findings published previously by Schneider et al. which showed the dystrophic mouse muscle had reduced SERCA1 expression and enhanced expression of SLN, and expand this observation to several muscles which were not assessed in the earlier study. It is important to make note that the only muscle which did not show changes between control and mdx was in the soleus (except for SLN, which was still significantly elevated in the soleus). This finding suggests alterations in protein expression may be limited to fasttwitch muscle fibers, while slow-twitch fibers like the soleus remain relatively unaffected. The major finding of this study was that sAnk1 expression was found to decrease in mdx muscle, and suggests that alterations in sAnk1 protein levels may contribute to
103
elevate intracellular Ca2+ in mdx mouse muscle. Interestingly immunoblots of sAnk1 reveal a band at the expected MW of ~17 kDa and a band appearing as a doublet at ~ 25 kDa. It is currently unclear what contributes to the appearance of this higher MW doublet, but we speculate it is due to post translational modifications or an unidentified splice variant of the Ank1 transcript. Quantitative analysis show that both MW forms of sAnk1 are reduced, and that this reduction is more dramatic for the higher MW form. It will be interesting in the future to look at how sAnk1 expression changes in the mdx/Utr-/mouse, and if these changes are more pronounced that those observed for the mdx mouse as is the case for SLN (196). We also investigated the dysferlinopathic Bla J mouse model of muscular dystrophy for alterations in SERCA1, sAnk1 and SLN expression levels. Unlike mdx quadriceps muscle, Bla J showed no alterations in any of proteins analyzed. This finding suggests that targeting SERCA1 or its regulators (sAnk1 and SLN) may be beneficial in treating DMD while ineffective for other types of MD. We have shown before that sAnk1 inhibits SERCA1 activity in a similar way to SLN, but to a lesser extent. However that data presented in chapter 3 demonstrate that sAnk1 is also able to reduce SERCA1 inhibition by SLN. Therefore it is possible that the reduction in sAnk1 levels observed in mdx muscle tissue is a compensatory response to the reduced level of SERCA1 and increased level of SLN. It is also possible, however, that loss of sAnk1 exacerbates the disease state by allowing increased SERCA1 inhibition by SLN. Future studies aimed at determining the mechanism by which sAnk1 reduces SLN-mediated inhibition of SERCA1 will help us answer this question. We are currently conducting preliminary studies aimed to reveal if sAnk1 and SLN binding to SERCA1 are mutually exclusive, or if the two proteins can simultaneously bind to SERCA1
104
resulting in a 3-way complex (see chapter 5). Better understanding of the mechanisms by which sAnk1 and SLN coordinately modulate SERCA1 activity may provide insights for novel therapeutic approaches to restore Ca2+ homeostasis in diseases where its dysregulation contribute to pathogenesis.
105
Table 4.1. Expression levels of SERCA1, sAnk1, and SLN in mdx tissue. Expression levels were measured via immunoblotting and quantified using densitometric analysis after normalization to GAPDH. Values represent percent expression relative to control C57BL/10 ScSnJ mice.
106
Figure 4.1. Immunoblot comparison of control and mdx mouse muscle tissue. A-F. Tibialis anterior (TA), gastrocnemius (GAS), quadriceps (QUAD), soleus (SOL), extensor digitorum brevis (EDL) and heart tissues from control C57BL/10 ScSnJ and dystrophic mdx mice were assessed for expression of SERCA1, GAPDH, sAnk1, and SLN via immunoblot analysis. Expression levels were quantified using Image J for densitometric analysis and normalized to GAPDH which served as a loading control.
107
108
Figure 4.2. Graphical comparison of control and mdx mouse muscle tissue. The fold change of SERCA1 (A), SLN (B), and the upper and lower bands of sAnk1 (C and D, respectively) in mdx mouse muscle tissue compared to C57BL/10 ScSnJ are shown for the indicated muscles. In most cases, SERCA1 and sAnk1 levels were significantly reduced in mdx mice, while SLN was significantly increased. Statistics measured via Students T-test: *, p < 0.05; **, p < 0.01; ns, not significant.
109
Figure 4.3. Comparison of Ca2+ handling proteins in dysferlinopathic mouse model (BlaJ). A. Immunoblot analysis of SERCA1, GAPDH, sAnk1, and SLN in control C57BL/6 and Bla J quadricep muscle. Expression levels were quantified using Image J for densitometric analysis and normalized to GAPDH which served as a loading control. B. Graphical representation of protein expression level. The level of expression in Bla J was compared to C57BL/6 (normalized to equal 1). No statistically significant differences were observed.
110
Chapter V. Comprehensive discussion, preliminary studies, and future direction The work presented in this dissertation demonstrates that sAnk1 and SERCA1 bind to one another via transmembrane and cytoplasmic interactions. The transmembrane interactions are essential for sAnk1’s ability to modulate SERCA1 activity. Furthermore, interactions between sAnk1 and SLN reduce SLN-mediated SERCA1 inhibition. This document also reports alterations in sAnk1 expression levels in the mdx mouse model of Duchenne’s muscular dystrophy (DMD) that are specific, as they are not seen in the BlaJ model of LGMD2B. Together, my results suggest that sAnk1 is an important regulator of Ca2+ homeostasis in skeletal muscle, and implicate a possible link between altered sAnk1 protein expression and the elevated cytosolic Ca2+ levels associated with DMD. This final chapter focuses on preliminary studies and future directions of this project. A. Characterization of the interaction between sAnk1 and SERCA1 The work presented in chapter 2 laid the groundwork toward characterizing the interaction between SERCA1 and sAnk1. While it is clear that the transmembrane domain of sAnk1 is important for binding to SERCA1 and critical to sAnk1’s ability to regulate SERCA1 activity, the specific residues that confer this regulatory function remain unknown. To address this questions, future studies could employ site directed mutagenesis in order to identify those residues within the transmembrane domain that are important for sAnk1’s inhibitory activity. The model shown in Fig. 2.8 highlights the residues on sAnk1 which are similar to those found on SLN, and provide a starting point for determining the functionally important residues. Several of the conserved residues shown in Fig. 2.8, panels a and c, have previously been found necessary for SLN’s ability 111
to bind to an inhibit SERCA activity (e.g. SLN residues V19 and L21 which correspond to sAnk1 residues V10 and L8). To begin elucidating the specific residues important for sAnk1 binding or modulating SERCA1 we will shift V10 and T11 to different positions within the sAnk1 transmembrane domain using site directed mutagenesis (Fig. 5.1). These residues correspond to residues V19 and T18 of SLN and are predicted to fit within the binding pocket of SERCA1 made up by transmembrane helices M2, M6, and M9. The prediction is that if these residues are indeed similar to those conserved with SLN, shifting their position within the membrane will alter sAnk1’s ability to bind to SERCA1 as measured by co-IP or AFRET. Furthermore, if these residues are required for sAnk1’s inhibitory activity, ATPase measurements will show that the mutant sAnk1 is unable to shift SERCA1’s apparent Ca2+ affinity. Alternatively, they may be only 2 of several residues in sAnk1’s transmembrane domain that are required, or they may not be involved at all. In the latter case, mutagenesis should have no effect on sAnk1’s inhibitory activity; in the former, the effect of mutagenesis may only partial effect SERCA1’s ATPase activity. Additionally, site directed mutagenesis of residues within the cytoplasmic domain of sAnk1 may help us understand which regions of sAnk1 are interacting with SERCA in the cytosol. We have several sAnk1 mutants which have residues important for binding obscurin available in our laboratory for initial testing. These include sAnk1 R68E, K101E, and the combination of both mutants. Other mutants which have been produced previously and may be worth experimental consideration are sAnk1 E83K, E87K, E88K, E93K, and combinations of these mutations. These amino acid residues are hypothesized to be important for sAnk1-titin interactions, though they were never fully tested. Another
112
interesting set of experiments that could help us better understand how sAnk1 inhibits SERCA1 activity is to create chimeric fusion proteins composed of sections of sAnk1 with SLN or PLN similar to previous studies by Gorski et al. (84) . By switching the cytoplasmic, transmembrane, and luminal domains for these proteins we could determine how each piece affects the chimaera’s ability to interact with SERCA and modulate its activity. Chimaeras of SERCA1, in which regions of the enzyme are replaced with limited cytoplasmic sequences of the Na,K-ATPase alpha subunit, the H+-ATPase, or PMCA, all of which have been used to create hybrid forms of SERCA (223-225), could be used similarly, to identify those regions of SERCA1 that interact with the cytoplasmic domain of sAnk1. B. Determining if sAnk1 and SLN bind SERCA1 simultaneously Although the data presented in chapter 3 show that sAnk1 interacts with SLN, and that SLN promotes interaction between sAnk1 and SERCA1, several questions remain. One question is how sAnk1 reduces SLN- mediated SERCA1 inhibition. Two possible mechanisms which may account for this effect are: i.) competition for binding to SERCA1, or ii.) formation of a distinct three-way complex which is less inhibitory than the complex formed by SLN and SERCA1. Distinguishing between two distinct 2-way complexes and a 3-way complex is no small task, but we have an exciting new experiment in progress that should help us do so. This experiment, suggested by Dr. M. Rizzo (Department of Physiology, University of Maryland School of Medicine) uses a combination of two fluorescent detection methods commonly used to investigate proteinprotein interactions. The first technique employs fusion protein constructs which tag the desired proteins of interest with the N- or C-terminal half of a mVenus (YFP) molecule 113
(226). If the proteins fused to either half of the YFP molecule interact with each other, it will bring the pieces of YFP close enough together for them to fold into the full YFP molecule. Since the individual halves will not fluoresce on their own, a fluorescent signal is a strong indicator of protein-protein interactions. The preliminary experiments in progress currently are using SERCA1 and sAnk1 fused to the half-YFP moieties. In combination with the method described above, FRET analysis will allow us to determine if we are obtaining a 3-way complex between SERCA, sAnk1, and SLN. The goal is to co-transfect the two fusion proteins described above containing the half-YFP domains along with SLN tagged with mCerulean (CFP) . We will then use AFRET analysis as described in our earlier experiments to determine if energy transfer is observed. The hypothesis is that if these proteins interact in a 3-way complex, the halfYFP molecules will fold together to create a functional YFP molecule. This full YFP protein can now serve as an acceptor fluorophore following excitation of the CFP-SLN only if the CFP-SLN is interacting with SERCA1 and sAnk1. Therefore the observations of energy transfer from CFP to the reformed YFP fluorophore will strongly suggest these proteins are all interacting with one another in a complex. The major advantage to this method is that false positives are highly unlikely since the YFP must reform and energy transfer must occur in order to have a positive result. These experiments are currently in progress by another graduate student in our laboratory, Amanda Labuza. Possible problems with this method include the efficiency of the reformation of YFP, and proper targeting of the proteins to the ER in the COS7 cells. It is also possible that the proteins may interact with each other, but in such a way that does not allow reformation of the YFP molecule or energy transfer between donor and acceptor
114
fluorophores. In this case we would first try switching the fluorescent tags on each of the proteins. It may also be possible to alter the length of the amino acid linker connecting the protein of interest to its fusion partner, to allow greater flexibility and thereby improve the chance of the two half Venus moieties associating. Another method which may be useful in addressing our question is to use Blue Native gels prepared from mild detergent extracts of COS7 cells that express SERCA1 with or without SLN and sAnk1, followed by immunoblotting. Despite the challenging nature of these experiments, they are likely the key in determining if sAnk1 and SLN are able to interact with SERCA1 simultaneously. Distinguishing between 2-way and 3-way complexes may begin to explain our result that SLN promotes sAnk1 and SERCA1 interaction. If we can determine that a 3way complex can form, it is possible that SERCA1 and SLN together comprise a distinct site for sAnk1 binding compared to the site it interacts with SERCA1 in the absence of SLN. This idea is similar to that proposed for the binding of SLN to PLN bound SERCA1 (55, 193) Another possible explanation of this is that SLN promotes a specific conformation of SERCA1 which opens up or stabilizes a second binding site on SERCA1 for sAnk1 (see chapter 3). X-ray crystallographic studies have shown that SLN (and PLN) prefer to bind to SERCA it is E1•Mg2+ state (194, 227) These studies use Mg2+ and TNP-AMP to stabilize SERCA in this conformation. An interesting study will be to coexpress sAnk1 and SERCA1 and perform co-IP experiments in the presence of Mg2+ and TNP-AMP. If SLN is promotes the E1•Mg2+ state of SERCA, having these components added to the experiment may promote a similar increase in co-IP between SERCA1 and sAnk1.
115
C. C34 of sAnk1 mediates homodimerization via disulfide linkage A major question that our laboratory has been addressing is if sAnk1 helps to link the SR to the contractile apparatus. To this end, we have shown that interactions between sAnk1 and the two giant myofibrillar proteins, obscurin and titin, are capable of mediating such a link (110, 114, 116, 160). The interaction surfaces on sAnk1 found to bind to obscurin have been modeled as two ankyrin-like repeat motifs (111-113). These ankyrin repeat domains, which consist of 33 amino acid residues, are well known motifs which mediate protein-protein interactions, including homodimerization (111). Some examples of ankyrin repeat domains mediating dimerization are found in Notch1, Tvl-1 and cpSRP (228-230). Interestingly, dimers of both Tvl-1 and cpSRP have affinity toward different binding partners than their monomeric counterparts. We have previously demonstrated that disulfide linkages stabilize homodimers of sAnk1 (91). sAnk1 contains cysteine residues C22 and C34, with the latter likely to mediate disulfide formation. This was further investigated by Ackermann et al. who showed that the mutation C34S eliminated dimerization of the cytoplasmic domain of sAnk1 (29-155) tagged with Maltose Binding Protein (MBP; (111)). My results in SR vesicle preparations and in COS7 cells transfected with various sAnk1 variants agree with these experiments. When SR vesicles prepared from rabbit skeletal muscle were boiled in sample loading buffer with 2-mercaptoethanol (2-ME) the characteristic doublet pattern at a MW of ~17 and 22kDa were observed when blotted with antibodies against sAnk1 (Fig. 5.2, lane 1). When the same samples were not exposed to 2-ME, a second faint set of bands can be seen at ~50 kDa in addition to the sAnk1 monomers (Fig 5.2, lane 2). When samples were treated with the irreversible
116
sulfhydryl crosslinker, bismaleimidohexane (BMH), prior to exposure with 2-ME, prominent bands were detected at ~50kDa (Fig. 5.2, lane 3). Controls for BMH treatment, vesicles treated with DMSO alone, showed no evidence of dimerization of sAnk1 (Fig. 5.2, lane 4). These results confirm previous findings that sAnk1 forms homodimers in native SR vesicles that are stabilized through disulfide bonds. We have generated constructs that encode the cytoplasmic domain of sAnk1 only (sAnk1 29-155, described in chapter 2) and the TM/juxtamembrane region (sAnk1 1-29). Since each of these include just one of the two cysteine residues (C22 or C34; Fig. 5.3a), we utilized them to transfect COS7 cells to help determine which cysteine mediates disulfide bond formation and sAnk1 dimerization. When 2-ME is excluded from sample preparation and analyzed via western blot, we find that sAnk1 (29-155) is also able to produce a signal at a MW corresponding to sAnk1 dimers similar to full-length sAnk1 (Fig 5.3b, lanes 1 and 3). When sAnk1 (1-29) is expressed in these cells we do not observe dimer formation (Fig. 5.3b, lane 2). This result suggests that C34, not C22, is responsible, and that the cytoplasmic domain of sAnk1, containing the ankyrin-like repeats, is sufficient for dimers to form. D. SLN promotes interaction between sAnk1 and Obscurin Binding of sAnk1 to the giant myofibrillar proteins obscurin and titin has been well characterized (112, 113, 116, 117, 160). Using site directed mutagenesis, our lab has mapped out the regions on sAnk1 and obscurin which mediate their binding (112114). Interestingly, it was previously observed that sAnk1 dimerization was able to promote obscurin binding (111). My studies on sAnk1, SERCA1 and SLN interactions raised the question of how their binding affects sAnk1-obscurin binding. Based on the 117
data of Ackermann et al., described above in section C of this chapter, and my observations, one possibility is that monomers and dimers of sAnk1 preferentially bind to SERCA1 or obscurin, respectively. The preliminary results I have obtained in support of this hypothesis, and the future experiments required to test it further, are discussed below. In order to determine how interactions among SERCA1, sAnk1, and SLN could affect sAnk1’s ability to bind to obscurin, we used lysates from COS7 cells transfected with various combinations of cDNAs in MBP ‘pull down’ experiments. These experiments utilized the fragment of obscurin containing both sAnk1 binding sites (ObscF3; see chapter 1 for a description of these sites). The studies were performed under reducing and non-reducing conditions to assess how self-association of sAnk1 may affect its binding. Under reducing conditions, we observed binding between Obsc (F3) and sAnk1-FLAG, as expected (Fig 5.4a). The presence of SERCA1did not affect the pulldown of sAnk1 with Obsc (F3) (compare lanes 2 and 4, middle panel, Fig. 5.4a). Surprisingly, the presence of FLAG-SLN resulted in a dramatic increase in the level of sAnk1-FLAG pull-down with Obsc (F3). Again, SERCA1 had no effect on this interaction (lanes 6 and 7, middle panel, Fig. 5.4a). We did observe a low level of SERCA1 pull-down with the Obscurin fragment, but this binding was observed at much longer exposure times and is likely non-specific, as similar levels of SERCA1 were pulled down from control samples using MBP protein alone. Hu et al. have recently shown that obscurin can associate with SERCA2a in cardiac muscle homogenates, but they utilized a different fragment of the obscurin protein, which may account for the differences observed (personal correspondence).
118
Non-reducing conditions revealed that that, in lysates containing only sAnk1FLAG, Obsc (F3) specifically pulled down the dimeric form of sAnk1 (Fig. 5.4c). The preferential binding of Obsc (F3) to dimeric sAnk1-FLAG is especially interesting based on the observation that monomeric sAnk1 is the predominant species, despite the nonreducing atmosphere (Fig. 5.4b, right panel). As was observed under reducing conditions, FLAG-SLN promoted the interaction of both the dimeric and monomeric forms of FLAG-sAnk1 and Obsc (F3), with the dimeric form being the predominant species pulled down (Fig. 5.4c). These results strengthen the observation made previously that obscurin preferentially interacts with dimerized sAnk1 (111), and supports the hypothesis that selfassociation between sAnk1 molecules helps determine whether it will interact with obscurin or SERCA1. Future co-IP experiments conducted under reducing and nonreducing conditions will be required to determine which species of sAnk1 preferentially interacts with SERCA1. We can also use the sAnk1 variants with mutants of the amino acids important for obscurin binding in co-IP experiments, to determine if it interacts with SERCA1 and SLN differently than WT sAnk1. E. sAnk1 expression is reduced in aging mouse skeletal muscle tissue In chapter 4, I presented data showing alterations in the expression of sAnk1 in mdx muscle. Our results are the first to implicate changes in sAnk1 as a possible factor contributing to the elevated cytosolic Ca2+ levels associated with muscular dystrophy. In addition to changes in Ca2+ handling proteins related to forms of muscular dystrophies, we have also begun to investigate age-related changes in these proteins. A recent study using the sAnk1 knock out mouse model showed that the loss of sAnk1 was associated 119
with minor functional changes in EC coupling which progressed with age (124). While impaired Ca2+ reuptake kinetics is inconsistent with our findings that sAnk1 acting to inhibit SERCA1, the authors suggest these changes may be due to partial loss of longitudinal SR and therefore local density of SERCA1 molecules. We have started to determine whether sAnk1 expression levels change in aging muscle naturally. This question was addressed via immunoblot analysis of the TA, gastroc, and heart muscles from 2 month and 18 month old C57BL/10 mice. We found that SERCA1 levels were unchanged between the two age groups of mice for all of the tissues assayed (Fig. 5.5a and b). Interestingly, sAnk1 expression decreased ~40-60% in the skeletal muscle tissue of 18 month old mice. This trend was opposite in heart tissue, as the older mice showed ~25% increases in sAnk1 levels (Fig. 5.5.a and b). More animals will be required in order to determine if these changes are statistically significant. The changes in SERCA1, sAnk1, and SLN in relation to aging were also investigated for the dysferlinopathic BlaJ mouse. For these experiments we compared levels of these proteins in 12 week and 12 month quadricep tissue in control (C57BL/6) and dysferlinopathic (BlaJ) mice by western blot (Fig. 5.6a). The comparison with 12 wk old C57BL/6 and BlaJ, shown previously in chapter 4, showed no significant differences in any of the proteins being studied. With age, both control and BlaJ quadriceps had a slight reduction in SERCA1 expression, but this decrease was not statistically significant (Fig. 5.6a and b). No significant changes were observed in the expression of the highest and lowest MW sAnk1 bands, although an intermediate band at ~20 kDa decreased in the 12 month old relative to the 12 wk old muscle (Fig. 5.6a and c-e). This change was statistically significant (p < 0.05) for control mice, but not BlaJ (p = 0.19). The most
120
noticeable change observed with age occurred for SLN expression. Interestingly, the C57BL/6 and BlaJ mice showed opposite changes with age (Fig.5.6a and f). In control mice there was a significant reduction in the level of SLN (5.8-fold; p < 0.01), while in BlaJ mice we found SLN expression dramatically increased (3.5-fold; p < 0.001). As mentioned before, there was no significant difference in SLN expression level between control and BlaJ at 12 weeks of age, in contrast to the two genotypes at 12 months of age, which show a 15.6-fold increase in SLN in BlaJ relative to controls (p < 0.001). These age-related changes in the proteins that regulate SERCA activity may correlate with changes in Ca2+ handling and muscle function with aging (231). We speculate that, similar to muscular dystrophies, abnormally high Ca2+ levels in the cytosol could be directly related to the muscle degeneration and wasting associated with sarcopenia that occurs in aging muscle. In the future we plan to expand this research to look at how these proteins change over time. It will also be interesting to look at how SERCA1 ATPase activity changes in various muscle tissues with age. F. The role of sAnk1 in other tissues. My studies have focused on sAnk1 interactions with SERCA1, SLN, and to a lesser extent obscurin, in skeletal muscle. It is important to point out that sAnk1 is also expressed at high levels in cardiac muscle, and may well be expressed in many other tissues. It will be interesting to begin investigating the role of sAnk1 in the heart, and if it is able to interact with SERCA2a in a similar way to SERCA1. I have shown that sAnk1 interacts with SLN to coordinately modulate SERCA1 activity, but have not yet begun to address the possibility that sAnk1 could interact with phospholamban. It is reasonable to hypothesize that sAnk1 may interact with PLN in a similar manner to coordinately 121
regulate SERCA2a activity in cardiac muscle. The differential expression of SLN and PLN in the atria and ventricles, respectively, suggests that sAnk1 may play distinct roles within different regions of the heart. While these ideas are speculative, immunoblot comparison of atrial and ventricular cardiac muscle in the future will be an important starting point at elucidating the potential role of sAnk1 in regulating Ca2+ in the heart. The interaction between sAnk1 and SERCA is not only interesting in striated muscle, but could also be important in non-muscle tissues. SERCA isoforms are ubiquitously expressed, and through alternative splicing, at least 14 isoforms of SERCA are known to exist. Currently, another graduate student in our laboratory, A. Labuza, is examining sAnk1 and SERCA2 in the brain, and how they may interact. The expression of sAnk1 in a variety of cell and tissue types suggests it may have a broader role in regulating SERCA activity.
122
Figure 5.1. sAnk1 transmembrane mutant sequence. Site-directed mutagenesis will be used to create mutants of the sAnk1 TM domain in order to assay its ability to bind to and inhibit SERCA1 ATPase activity. The bold TV is part of the TVLL sequence which is conserved between sAnk1 and SLN. Due to the hydrophilic nature of the threonine residue, and its predicted location within the SERCA1 TM binding pocket, this was elected as the first mutant to investigate.
123
Figure 5.2. Dimerization of sAnk1 through chemical crosslinking. Only monomeric sAnk1 was observed in untreated and DMSO treated SR vesicles prepared from rabbit skeletal muscle tissue.under reducing conditions (+2ME, lanes 1 and 4). Under non reducing conditions, a low level of dimeric sAnk1 was observed (lane 2). When vesicles were pretreated with the irreversible crosslinking reagent BMH (bismaleimdohexane), high levels of sAnk1 dimers were observed even under reducing conditions (lane 3). These results indicate that homodimers of sAnk1 are stabilized through disulfide linkages.
124
Figure 5.3. Cysteine 34 mediates sAnk1 dimerization. A. Schematic representation of sAnk1 protein with enlarged segment to highlight location of the two cysteine residues potentially responsible for sAnk1 homodimerization. B. Immunoblots from cells transfected to express full length (WT) sAnk1, sAnk1 (1-29), and sAnk1 (29-155) under non- reducing conditions reveal dimerized sAnk1 for WT sAnk1 and sAnk1 (29-155) (lane 1 and 3), but not for sAnk1(1-29) (lane 2). These results suggest that C34 mediates sAnk1 dimerization.
125
Figure 5.4. Dimeric sAnk1 preferentially interacts with obscurin and the interaction is enhanced by SLN. COS7 cells were transfected with 7 combinations of cDNAs (see key). Cells were transfected with empty vector to control for total cDNA used for transfection. A. sAnk1 and SLN were both detected on immunoblots by anti-FLAG antibody (middle and bottom sections, respectively). Inputs in the left panel show similar amounts of proteins in all experimental groups. Obscurin (F3)-MBP pulls down sAnk1 alone or in the presence of SERCA1 (middle panel, lanes 2 and 4). The presence of SLN greatly enhances the amount of sAnk1 that is pulled down with obscurin (middle panel, lanes 6 and 7). MBP protein does not pull down sAnk1 under any conditions to a significant level (right panel). Due to non-specific pulldown of SERCA1 and SLN by MBP, it remains unclear if obscurin interacts with either of these proteins specifically. B. The inputs were run under reducing (left panel) and non-reducing (right panel) conditions and subject to SDSPAGE. Non-reducing conditions reveal low levels of sAnk1 dimers relative to the amount of monomeric sAnk1. C. The same pull down experiments decribed in A were performed under non-reducing conditions. Dimeric sAnk1 is preferentially pulled down with the Obsc(F3)-MBP. Again, the presence of SLN promotes the interaction of sAnk1 and Obsc(F3)-MBP. MBP does not pull down sAnk1 under any conditions. SLN is pulled down with Obsc(F3)-MBP at low levels. As above, non-specific pull-down of SERCA1 is observed.
126
127
Figure 5.5. sAnk1 levels are reduced in aging mouse muscle tissue. A. Tibialis Anterior (TA), gastrocnemius (Gastroc), and heart tissue from 2 month and 18 month old control C57BL/10 ScSnJ mice were assayed via immunoblotting for SERCA and sAnk1 expression. B. Densitometric quantitation of these preliminary experiments showed reduced sAnk1 levels in TA and gastrocnemius, and increased levels in heart tissues of aging mice. SERCA1 levels were relatively unaffected.
128
129
Figure 5.6. Alterations of sAnk1 and SLN in aging, dysferlinopathic mouse muscle tissue. A. Levels of SERCA1, sAnk1 and SLN were investigated in quadriceps tissue from 12 week and 12 month control (C57BL/6) and dysferlinopathic (BlaJ) mice by western blot analysis. B. SERCA1 levels were slightly reduced in aging mice, but the decrease was not significant. C. The highest MW band of sAnk1 was unchanged in aging mice from either genetic backgrounds. D. Levels of the middle MW band of sAnk1 was significantly reduced in aging control mice. There was a small, but non-significant, reduction in BlaJ mice. E. The lowest MW form of sAnk1 was not changed with aging. F. SLN expression was significantly reduced in aging control quadriceps muscle and significantly up-regulated in aging BlaJ quadriceps tissue. Comparison of 12 month control vs BlaJ tissue showed SLN expression was greatly increased in BlaJ muscle.
130
131
Bibliography 1. Elaine N. Marieb, Katja Hoehn (2010) Human Anatomy & Physiology 312 2. Sanger, J.W., Sanger, J.M., and Franzini-Armstrong, C. (2004) Assembly of the skeletal muscle cell 45-65 3. Sanger, J.W., Kang, S., Siebrands, C.C., Freeman, N., Du, A., Wang, J., Stout, A.L., and Sanger, J.M. (2005) How to build a myofibril. J.Muscle Res.Cell.Motil. 26, 343-354 4. Clark, K.A., McElhinny, A.S., Beckerle, M.C., and Gregorio, C.C. (2002) Striated muscle cytoarchitecture: an intricate web of form and function. Annu.Rev.Cell Dev.Biol. 18, 637-706 5. Franzini-Armstrong, C., and Peachey, L.D. (1981) Striated muscle-contractile and control mechanisms. J.Cell Biol. 91, 166-186 6. Flucher, B.E., and Franzini-Armstrong, C. (1996) Formation of junctions involved in excitation-contraction coupling in skeletal and cardiac muscle. Proc.Natl.Acad.Sci.U.S.A. 93, 8101-8106 7. Schneider, M.F. (1994) Control of calcium release in functioning skeletal muscle fibers. Annu.Rev.Physiol. 56, 463-484 8. Amador, F.J., Stathopulos, P.B., Enomoto, M., and Ikura, M. (2013) Ryanodine receptor calcium release channels: lessons from structure-function studies. FEBS J. 280, 5456-5470 9. Franzini-Armstrong, C. (2004) Functional implications of RyR-dHPR relationships in skeletal and cardiac muscles. Biol.Res. 37, 507-512 10. Gyorke, I., Hester, N., Jones, L.R., and Gyorke, S. (2004) The role of calsequestrin, triadin, and junctin in conferring cardiac ryanodine receptor responsiveness to luminal calcium. Biophys.J. 86, 2121-2128 11. Franzini-Armstrong, C., Protasi, F., and Ramesh, V. (1999) Shape, size, and distribution of Ca(2+) release units and couplons in skeletal and cardiac muscles. Biophys.J. 77, 1528-1539 12. Fabiato, A. (1983) Calcium-induced release of calcium from the cardiac sarcoplasmic reticulum. Am.J.Physiol. 245, C1-14 13. Lin, J.J., Eppinga, R.D., Warren, K.S., and McCrae, K.R. (2008) Human tropomyosin isoforms in the regulation of cytoskeleton functions. Adv.Exp.Med.Biol. 644, 201-222
132
14. Zot, A.S., and Potter, J.D. (1987) Structural aspects of troponin-tropomyosin regulation of skeletal muscle contraction. Annu.Rev.Biophys.Biophys.Chem. 16, 535-559 15. Gordon, A.M., Homsher, E., and Regnier, M. (2000) Regulation of contraction in striated muscle. Physiol.Rev. 80, 853-924 16. Franzini-Armstrong, C. (1999) The sarcoplasmic reticulum and the control of muscle contraction. FASEB J. 13 Suppl 2, S266-70 17. Floyd, K. (1980) The physiology of striated muscle. Br.J.Anaesth. 52, 111-121 18. Toyoshima, C. (2009) How Ca2+-ATPase pumps ions across the sarcoplasmic reticulum membrane. Biochim.Biophys.Acta. 1793, 941-946 19. Somlyo, A.V., Gonzalez-Serratos, H.G., Shuman, H., McClellan, G., and Somlyo, A.P. (1981) Calcium release and ionic changes in the sarcoplasmic reticulum of tetanized muscle: an electron-probe study. J.Cell Biol. 90, 577-594 20. Ziman, A.P., Ward, C.W., Rodney, G.G., Lederer, W.J., and Bloch, R.J. (2010) Quantitative measurement of Ca(2)(+) in the sarcoplasmic reticulum lumen of mammalian skeletal muscle. Biophys.J. 99, 2705-2714 21. Launikonis, B.S., Zhou, J., Royer, L., Shannon, T.R., Brum, G., and Rios, E. (2005) Confocal imaging of [Ca2+] in cellular organelles by SEER, shifted excitation and emission ratioing of fluorescence. J.Physiol. 567, 523-543 22. Kabbara, A.A., and Allen, D.G. (1999) Measurement of sarcoplasmic reticulum Ca2+ content in intact amphibian skeletal muscle fibres with 4-chloro-m-cresol. Cell Calcium. 25, 227-235 23. Saris, N.E., and Carafoli, E. (2005) A historical review of cellular calcium handling, with emphasis on mitochondria. Biochemistry (Mosc). 70, 187-194 24. Koivumaki, J.T., Takalo, J., Korhonen, T., Tavi, P., and Weckstrom, M. (2009) Modelling sarcoplasmic reticulum calcium ATPase and its regulation in cardiac myocytes. Philos.Trans.A.Math.Phys.Eng.Sci. 367, 2181-2202 25. Bublitz, M., Morth, J.P., and Nissen, P. (2011) P-type ATPases at a glance. J.Cell.Sci. 124, 2515-2519 26. Olesen, C., Picard, M., Winther, A.M., Gyrup, C., Morth, J.P., Oxvig, C., Moller, J.V., and Nissen, P. (2007) The structural basis of calcium transport by the calcium pump. Nature. 450, 1036-1042 27. Toyoshima, C., and Cornelius, F. (2013) New crystal structures of PII-type ATPases: excitement continues. Curr.Opin.Struct.Biol. 23, 507-514 133
28. Elie, R.C., Regis, B., Serge, A., and Roger J Hajjar and Larissa,Lipskaia (2013) Sarco (Endo) Plasmic Reticulum Calcium Atpases (SERCA) Isoforms in the Normal and Diseased Cardiac, Vascular and Skeletal Muscle. Journal of Cardiovascular Diseases and Diagnosis. 1, 29. Periasamy, M., and Kalyanasundaram, A. (2007) SERCA pump isoforms: their role in calcium transport and disease. Muscle Nerve. 35, 430-442 30. Brandl, C.J., deLeon, S., Martin, D.R., and MacLennan, D.H. (1987) Adult forms of the Ca2+ATPase of sarcoplasmic reticulum. Expression in developing skeletal muscle. J.Biol.Chem. 262, 3768-3774 31. Toyoshima, C. (2008) Structural aspects of ion pumping by Ca2+-ATPase of sarcoplasmic reticulum. Arch.Biochem.Biophys. 476, 3-11 32. Treiman, M., Caspersen, C., and Christensen, S.B. (1998) A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmic reticulum Ca(2+)-ATPases. Trends Pharmacol.Sci. 19, 131-135 33. Soler, F., Plenge-Tellechea, F., Fortea, I., and Fernandez-Belda, F. (1998) Cyclopiazonic acid effect on Ca2+-dependent conformational states of the sarcoplasmic reticulum ATPase. Implication for the enzyme turnover. Biochemistry. 37, 4266-4274 34. Lytton, J., Westlin, M., and Hanley, M.R. (1991) Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J.Biol.Chem. 266, 17067-17071 35. Sabala, P., Czarny, M., Woronczak, J.P., and Baranska, J. (1993) Thapsigargin: potent inhibitor of Ca2+ transport ATP-ases of endoplasmic and sarcoplasmic reticulum. Acta Biochim.Pol. 40, 309-319 36. Urbina, D.C., Silva, H., and Meisel, L.A. (2006) The Ca2+ pump inhibitor, thapsigargin, inhibits root gravitropism in Arabidopsis thaliana. Biol.Res. 39, 289-296 37. Dremina, E.S., Sharov, V.S., Kumar, K., Zaidi, A., Michaelis, E.K., and Schoneich, C. (2004) Anti-apoptotic protein Bcl-2 interacts with and destabilizes the sarcoplasmic/endoplasmic reticulum Ca2+-ATPase (SERCA). Biochem.J. 383, 361-370 38. Dremina, E.S., Sharov, V.S., and Schoneich, C. (2012) Heat-shock proteins attenuate SERCA inactivation by the anti-apoptotic protein Bcl-2: possible implications for the ER Ca2+-mediated apoptosis. Biochem.J. 444, 127-139 39. Green, K.N., Demuro, A., Akbari, Y., Hitt, B.D., Smith, I.F., Parker, I., and LaFerla, F.M. (2008) SERCA pump activity is physiologically regulated by presenilin and regulates amyloid beta production. J.Cell Biol. 181, 1107-1116
134
40. Vafiadaki, E., Arvanitis, D.A., Pagakis, S.N., Papalouka, V., Sanoudou, D., Kontrogianni-Konstantopoulos, A., and Kranias, E.G. (2009) The anti-apoptotic protein HAX-1 interacts with SERCA2 and regulates its protein levels to promote cell survival. Mol.Biol.Cell. 20, 306-318 41. Anderson, D.M., Anderson, K.M., Chang, C.L., Makarewich, C.A., Nelson, B.R., McAnally, J.R., Kasaragod, P., Shelton, J.M., Liou, J., Bassel-Duby, R., and Olson, E.N. (2015) A micropeptide encoded by a putative long noncoding RNA regulates muscle performance. Cell. 160, 595-606 42. Tada, M., Kirchberger, M.A., Repke, D.I., and Katz, A.M. (1974) The stimulation of calcium transport in cardiac sarcoplasmic reticulum by adenosine 3':5'-monophosphatedependent protein kinase. J.Biol.Chem. 249, 6174-6180 43. Bhupathy, P., Babu, G.J., and Periasamy, M. (2007) Sarcolipin and phospholamban as regulators of cardiac sarcoplasmic reticulum Ca2+ ATPase. J.Mol.Cell.Cardiol. 42, 903-911 44. Stammers, A.N., Susser, S.E., Hamm, N.C., Hlynsky, M.W., Kimber, D.E., Kehler, D.S., and Duhamel, T.A. (2015) The regulation of sarco(endo)plasmic reticulum calciumATPases (SERCA). Can.J.Physiol.Pharmacol. 1-12 45. Koss, K.L., Ponniah, S., Jones, W.K., Grupp, I.L., and Kranias, E.G. (1995) Differential phospholamban gene expression in murine cardiac compartments. Molecular and physiological analyses. Circ.Res. 77, 342-353 46. Tada, M., and Toyofuku, T. (1998) Molecular regulation of phospholamban function and expression. Trends Cardiovasc.Med. 8, 330-340 47. Briggs, F.N., Lee, K.F., Wechsler, A.W., and Jones, L.R. (1992) Phospholamban expressed in slow-twitch and chronically stimulated fast-twitch muscles minimally affects calcium affinity of sarcoplasmic reticulum Ca(2+)-ATPase. J.Biol.Chem. 267, 26056-26061 48. Odermatt, A., Taschner, P.E., Scherer, S.W., Beatty, B., Khanna, V.K., Cornblath, D.R., Chaudhry, V., Yee, W.C., Schrank, B., Karpati, G., Breuning, M.H., Knoers, N., and MacLennan, D.H. (1997) Characterization of the gene encoding human sarcolipin (SLN), a proteolipid associated with SERCA1: absence of structural mutations in five patients with Brody disease. Genomics. 45, 541-553 49. Bhupathy, P., Babu, G.J., and Periasamy, M. (2007) Sarcolipin and phospholamban as regulators of cardiac sarcoplasmic reticulum Ca2+ ATPase. J.Mol.Cell.Cardiol. 42, 903-911
135
50. Babu, G.J., Zheng, Z., Natarajan, P., Wheeler, D., Janssen, P.M., and Periasamy, M. (2005) Overexpression of sarcolipin decreases myocyte contractility and calcium transient. Cardiovasc.Res. 65, 177-186 51. Morita, T., Hussain, D., Asahi, M., Tsuda, T., Kurzydlowski, K., Toyoshima, C., and Maclennan, D.H. (2008) Interaction sites among phospholamban, sarcolipin, and the sarco(endo)plasmic reticulum Ca(2+)-ATPase. Biochem.Biophys.Res.Commun. 369, 188194 52. Toyofuku, T., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1994) Amino acids Glu2 to Ile18 in the cytoplasmic domain of phospholamban are essential for functional association with the Ca(2+)-ATPase of sarcoplasmic reticulum. J.Biol.Chem. 269, 3088-3094 53. Toyofuku, T., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1994) Amino acids Lys-Asp-Asp-Lys-Pro-Val402 in the Ca(2+)-ATPase of cardiac sarcoplasmic reticulum are critical for functional association with phospholamban. J.Biol.Chem. 269, 22929-22932 54. Asahi, M., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (2002) Sarcolipin inhibits polymerization of phospholamban to induce superinhibition of sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs). J.Biol.Chem. 277, 2672526728 55. Asahi, M., Sugita, Y., Kurzydlowski, K., De Leon, S., Tada, M., Toyoshima, C., and MacLennan, D.H. (2003) Sarcolipin regulates sarco(endo)plasmic reticulum Ca2+ATPase (SERCA) by binding to transmembrane helices alone or in association with phospholamban. Proc.Natl.Acad.Sci.U.S.A. 100, 5040-5045 56. Odermatt, A., Becker, S., Khanna, V.K., Kurzydlowski, K., Leisner, E., Pette, D., and MacLennan, D.H. (1998) Sarcolipin regulates the activity of SERCA1, the fast-twitch skeletal muscle sarcoplasmic reticulum Ca2+-ATPase. J.Biol.Chem. 273, 12360-12369 57. MacLennan, D.H., Asahi, M., and Tupling, A.R. (2003) The regulation of SERCAtype pumps by phospholamban and sarcolipin. Ann.N.Y.Acad.Sci. 986, 472-480 58. Kirchberger, M.A., Tada, M., and Katz, A.M. (1974) Adenosine 3':5'monophosphate-dependent protein kinase-catalyzed phosphorylation reaction and its relationship to calcium transport in cardiac sarcoplasmic reticulum. J.Biol.Chem. 249, 6166-6173 59. Tada, M., Kirchberger, M.A., and Li, H.C. (1975) Phosphoprotein phosphatasecatalyzed dephosphorylation of the 22,000 dalton phosphoprotein of cardiac sarcoplasmic reticulum. J.Cyclic Nucleotide Res. 1, 329-338
136
60. Le Peuch, C.J., Haiech, J., and Demaille, J.G. (1979) Concerted regulation of cardiac sarcoplasmic reticulum calcium transport by cyclic adenosine monophosphate dependent and calcium--calmodulin-dependent phosphorylations. Biochemistry. 18, 5150-5157 61. Fujii, J., Maruyama, K., Tada, M., and MacLennan, D.H. (1989) Expression and sitespecific mutagenesis of phospholamban. Studies of residues involved in phosphorylation and pentamer formation. J.Biol.Chem. 264, 12950-12955 62. Simmerman, H.K., Collins, J.H., Theibert, J.L., Wegener, A.D., and Jones, L.R. (1986) Sequence analysis of phospholamban. Identification of phosphorylation sites and two major structural domains. J.Biol.Chem. 261, 13333-13341 63. Wittmann, T., Lohse, M.J., and Schmitt, J.P. (2015) Phospholamban pentamers attenuate PKA-dependent phosphorylation of monomers. J.Mol.Cell.Cardiol. 80, 90-97 64. Asahi, M., McKenna, E., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (2000) Physical interactions between phospholamban and sarco(endo)plasmic reticulum Ca2+ATPases are dissociated by elevated Ca2+, but not by phospholamban phosphorylation, vanadate, or thapsigargin, and are enhanced by ATP. J.Biol.Chem. 275, 15034-15038 65. Chen, Z., Akin, B.L., and Jones, L.R. (2010) Ca2+ binding to site I of the cardiac Ca2+ pump is sufficient to dissociate phospholamban. J.Biol.Chem. 285, 3253-3260 66. MacLennan, D.H., and Kranias, E.G. (2003) Phospholamban: a crucial regulator of cardiac contractility. Nat.Rev.Mol.Cell Biol. 4, 566-577 67. Luo, W., Grupp, I.L., Harrer, J., Ponniah, S., Grupp, G., Duffy, J.J., Doetschman, T., and Kranias, E.G. (1994) Targeted ablation of the phospholamban gene is associated with markedly enhanced myocardial contractility and loss of beta-agonist stimulation. Circ.Res. 75, 401-409 68. Kadambi, V.J., Ponniah, S., Harrer, J.M., Hoit, B.D., Dorn, G.W.,2nd, Walsh, R.A., and Kranias, E.G. (1996) Cardiac-specific overexpression of phospholamban alters calcium kinetics and resultant cardiomyocyte mechanics in transgenic mice. J.Clin.Invest. 97, 533-539 69. Gramolini, A.O., Trivieri, M.G., Oudit, G.Y., Kislinger, T., Li, W., Patel, M.M., Emili, A., Kranias, E.G., Backx, P.H., and Maclennan, D.H. (2006) Cardiac-specific overexpression of sarcolipin in phospholamban null mice impairs myocyte function that is restored by phosphorylation. Proc.Natl.Acad.Sci.U.S.A. 103, 2446-2451 70. Bhupathy, P., Babu, G.J., Ito, M., and Periasamy, M. (2009) Threonine-5 at the Nterminus can modulate sarcolipin function in cardiac myocytes. J.Mol.Cell.Cardiol. 47, 723-729
137
71. Shanmugam, M., Gao, S., Hong, C., Fefelova, N., Nowycky, M.C., Xie, L.H., Periasamy, M., and Babu, G.J. (2011) Ablation of phospholamban and sarcolipin results in cardiac hypertrophy and decreased cardiac contractility. Cardiovasc.Res. 89, 353-361 72. Shanmugam, M., Molina, C.E., Gao, S., Severac-Bastide, R., Fischmeister, R., and Babu, G.J. (2011) Decreased sarcolipin protein expression and enhanced sarco(endo)plasmic reticulum Ca2+ uptake in human atrial fibrillation. Biochem.Biophys.Res.Commun. 410, 97-101 73. Smith, W.S., Broadbridge, R., East, J.M., and Lee, A.G. (2002) Sarcolipin uncouples hydrolysis of ATP from accumulation of Ca2+ by the Ca2+-ATPase of skeletal-muscle sarcoplasmic reticulum. Biochem.J. 361, 277-286 74. Mall, S., Broadbridge, R., Harrison, S.L., Gore, M.G., Lee, A.G., and East, J.M. (2006) The presence of sarcolipin results in increased heat production by Ca(2+)-ATPase. J.Biol.Chem. 281, 36597-36602 75. Sahoo, S.K., Shaikh, S.A., Sopariwala, D.H., Bal, N.C., and Periasamy, M. (2013) Sarcolipin protein interaction with sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA) is distinct from phospholamban protein, and only sarcolipin can promote uncoupling of the SERCA pump. J.Biol.Chem. 288, 6881-6889 76. Bombardier, E., Smith, I.C., Gamu, D., Fajardo, V.A., Vigna, C., Sayer, R.A., Gupta, S.C., Bal, N.C., Periasamy, M., and Tupling, A.R. (2013) Sarcolipin trumps betaadrenergic receptor signaling as the favored mechanism for muscle-based diet-induced thermogenesis. FASEB J. 27, 3871-3878 77. Bombardier, E., Smith, I.C., Vigna, C., Fajardo, V.A., and Tupling, A.R. (2013) Ablation of sarcolipin decreases the energy requirements for Ca2+ transport by sarco(endo)plasmic reticulum Ca2+-ATPases in resting skeletal muscle. FEBS Lett. 587, 1687-1692 78. Bal, N.C., Maurya, S.K., Sopariwala, D.H., Sahoo, S.K., Gupta, S.C., Shaikh, S.A., Pant, M., Rowland, L.A., Bombardier, E., Goonasekera, S.A., Tupling, A.R., Molkentin, J.D., and Periasamy, M. (2012) Sarcolipin is a newly identified regulator of muscle-based thermogenesis in mammals. Nat.Med. 18, 1575-1579 79. Sopariwala, D.H., Pant, M., Shaikh, S.A., Goonasekera, S.A., Molkentin, J.D., Weisleder, N., Ma, J., Pan, Z., and Periasamy, M. (2015) Sarcolipin overexpression improves muscle energetics and reduces fatigue. J.Appl.Physiol.(1985). 118, 1050-1058 80. Gamu, D., Bombardier, E., Smith, I.C., Fajardo, V.A., and Tupling, A.R. (2014) Sarcolipin provides a novel muscle-based mechanism for adaptive thermogenesis. Exerc.Sport Sci.Rev. 42, 136-142
138
81. Tupling, A.R., Bombardier, E., Gupta, S.C., Hussain, D., Vigna, C., Bloemberg, D., Quadrilatero, J., Trivieri, M.G., Babu, G.J., Backx, P.H., Periasamy, M., MacLennan, D.H., and Gramolini, A.O. (2011) Enhanced Ca2+ transport and muscle relaxation in skeletal muscle from sarcolipin-null mice. Am.J.Physiol.Cell.Physiol. 301, C841-9 82. Buffy, J.J., Buck-Koehntop, B.A., Porcelli, F., Traaseth, N.J., Thomas, D.D., and Veglia, G. (2006) Defining the intramembrane binding mechanism of sarcolipin to calcium ATPase using solution NMR spectroscopy. J.Mol.Biol. 358, 420-429 83. Fajardo, V.A., Bombardier, E., Vigna, C., Devji, T., Bloemberg, D., Gamu, D., Gramolini, A.O., Quadrilatero, J., and Tupling, A.R. (2013) Co-expression of SERCA isoforms, phospholamban and sarcolipin in human skeletal muscle fibers. PLoS One. 8, e84304 84. Gorski, P.A., Glaves, J.P., Vangheluwe, P., and Young, H.S. (2013) Sarco(endo)plasmic reticulum calcium ATPase (SERCA) inhibition by sarcolipin is encoded in its luminal tail. J.Biol.Chem. 288, 8456-8467 85. Wegener, A.D., and Jones, L.R. (1984) Phosphorylation-induced mobility shift in phospholamban in sodium dodecyl sulfate-polyacrylamide gels. Evidence for a protein structure consisting of multiple identical phosphorylatable subunits. J.Biol.Chem. 259, 1834-1841 86. Kelly, E.M., Hou, Z., Bossuyt, J., Bers, D.M., and Robia, S.L. (2008) Phospholamban oligomerization, quaternary structure, and sarco(endo)plasmic reticulum calcium ATPase binding measured by fluorescence resonance energy transfer in living cells. J.Biol.Chem. 283, 12202-12211 87. Simmerman, H.K., Kobayashi, Y.M., Autry, J.M., and Jones, L.R. (1996) A leucine zipper stabilizes the pentameric membrane domain of phospholamban and forms a coiled-coil pore structure. J.Biol.Chem. 271, 5941-5946 88. Hellstern, S., Pegoraro, S., Karim, C.B., Lustig, A., Thomas, D.D., Moroder, L., and Engel, J. (2001) Sarcolipin, the shorter homologue of phospholamban, forms oligomeric structures in detergent micelles and in liposomes. J.Biol.Chem. 276, 30845-30852 89. Autry, J.M., Rubin, J.E., Pietrini, S.D., Winters, D.L., Robia, S.L., and Thomas, D.D. (2011) Oligomeric interactions of sarcolipin and the Ca-ATPase. J.Biol.Chem. 286, 31697-31706 90. Cornea, R.L., Autry, J.M., Chen, Z., and Jones, L.R. (2000) Reexamination of the role of the leucine/isoleucine zipper residues of phospholamban in inhibition of the Ca2+ pump of cardiac sarcoplasmic reticulum. J.Biol.Chem. 275, 41487-41494
139
91. Porter, N.C., Resneck, W.G., O'Neill, A., Van Rossum, D.B., Stone, M.R., and Bloch, R.J. (2005) Association of small ankyrin 1 with the sarcoplasmic reticulum. Mol.Membr.Biol. 22, 421-432 92. Gagelin, C., Constantin, B., Deprette, C., Ludosky, M.A., Recouvreur, M., Cartaud, J., Cognard, C., Raymond, G., and Kordeli, E. (2002) Identification of Ank(G107), a muscle-specific ankyrin-G isoform. J.Biol.Chem. 277, 12978-12987 93. Maiweilidan, Y., Klauza, I., and Kordeli, E. (2011) Novel interactions of ankyrins-G at the costameres: the muscle-specific Obscurin/Titin-Binding-related Domain (OTBD) binds plectin and filamin C. Exp.Cell Res. 317, 724-736 94. Kashef, F., Li, J., Wright, P., Snyder, J., Suliman, F., Kilic, A., Higgins, R.S., Anderson, M.E., Binkley, P.F., Hund, T.J., and Mohler, P.J. (2012) Ankyrin-B protein in heart failure: identification of a new component of metazoan cardioprotection. J.Biol.Chem. 287, 30268-30281 95. Rubtsov, A.M., and Lopina, O.D. (2000) Ankyrins. FEBS Lett. 482, 1-5 96. Bennett, V., and Stenbuck, P.J. (1979) Identification and partial purification of ankyrin, the high affinity membrane attachment site for human erythrocyte spectrin. J.Biol.Chem. 254, 2533-2541 97. Bennett, V. (1990) Spectrin-based membrane skeleton: a multipotential adaptor between plasma membrane and cytoplasm. Physiol.Rev. 70, 1029-1065 98. Bennett, V. (1992) Ankyrins. Adaptors between diverse plasma membrane proteins and the cytoplasm. J.Biol.Chem. 267, 8703-8706 99. Mosavi, L.K., Cammett, T.J., Desrosiers, D.C., and Peng, Z.Y. (2004) The ankyrin repeat as molecular architecture for protein recognition. Protein Sci. 13, 1435-1448 100. Michaely, P., and Bennett, V. (1992) The ANK repeat: a ubiquitous motif involved in macromolecular recognition. Trends Cell Biol. 2, 127-129 101. Mohler, P.J., Splawski, I., Napolitano, C., Bottelli, G., Sharpe, L., Timothy, K., Priori, S.G., Keating, M.T., and Bennett, V. (2004) A cardiac arrhythmia syndrome caused by loss of ankyrin-B function. Proc.Natl.Acad.Sci.U.S.A. 101, 9137-9142 102. Mohler, P.J., Davis, J.Q., and Bennett, V. (2005) Ankyrin-B coordinates the Na/K ATPase, Na/Ca exchanger, and InsP3 receptor in a cardiac T-tubule/SR microdomain. PLoS Biol. 3, e423 103. Li, J., Kline, C.F., Hund, T.J., Anderson, M.E., and Mohler, P.J. (2010) Ankyrin-B regulates Kir6.2 membrane expression and function in heart. J.Biol.Chem. 285, 2872328730 140
104. Mohler, P.J., Schott, J.J., Gramolini, A.O., Dilly, K.W., Guatimosim, S., duBell, W.H., Song, L.S., Haurogne, K., Kyndt, F., Ali, M.E., Rogers, T.B., Lederer, W.J., Escande, D., Le Marec, H., and Bennett, V. (2003) Ankyrin-B mutation causes type 4 long-QT cardiac arrhythmia and sudden cardiac death. Nature. 421, 634-639 105. Mohler, P.J., and Bennett, V. (2005) Ankyrin-based cardiac arrhythmias: a new class of channelopathies due to loss of cellular targeting. Curr.Opin.Cardiol. 20, 189-193 106. Mohler, P.J. (2006) Ankyrins and human disease: what the electrophysiologist should know. J.Cardiovasc.Electrophysiol. 17, 1153-1159 107. Hopitzan, A.A., Baines, A.J., Ludosky, M.A., Recouvreur, M., and Kordeli, E. (2005) Ankyrin-G in skeletal muscle: tissue-specific alternative splicing contributes to the complexity of the sarcolemmal cytoskeleton. Exp.Cell Res. 309, 86-98 108. Birkenmeier, C.S., Sharp, J.J., Gifford, E.J., Deveau, S.A., and Barker, J.E. (1998) An alternative first exon in the distal end of the erythroid ankyrin gene leads to production of a small isoform containing an NH2-terminal membrane anchor. Genomics. 50, 79-88 109. Zhou, D., Birkenmeier, C.S., Williams, M.W., Sharp, J.J., Barker, J.E., and Bloch, R.J. (1997) Small, membrane-bound, alternatively spliced forms of ankyrin 1 associated with the sarcoplasmic reticulum of mammalian skeletal muscle. J.Cell Biol. 136, 621-631 110. Armani, A., Galli, S., Giacomello, E., Bagnato, P., Barone, V., Rossi, D., and Sorrentino, V. (2006) Molecular interactions with obscurin are involved in the localization of muscle-specific small ankyrin1 isoforms to subcompartments of the sarcoplasmic reticulum. Exp.Cell Res. 312, 3546-3558 111. Borzok, M.A. (2008) Identifying the roles of Small Ankyrin 1 through its interaaction with Obscurin. Ph.D. thesis, University of Maryland Baltimore 112. Busby, B., Willis, C.D., Ackermann, M.A., Kontrogianni-Konstantopoulos, A., and Bloch, R.J. (2010) Characterization and comparison of two binding sites on obscurin for small ankyrin 1. Biochemistry. 49, 9948-9956 113. Busby, B., Oashi, T., Willis, C.D., Ackermann, M.A., KontrogianniKonstantopoulos, A., Mackerell, A.D.,Jr, and Bloch, R.J. (2011) Electrostatic interactions mediate binding of obscurin to small ankyrin 1: biochemical and molecular modeling studies. J.Mol.Biol. 408, 321-334 114. Borzok, M.A., Catino, D.H., Nicholson, J.D., Kontrogianni-Konstantopoulos, A., and Bloch, R.J. (2007) Mapping the binding site on small ankyrin 1 for obscurin. J.Biol.Chem. 282, 32384-32396
141
115. Kontrogianni-Konstantopoulos, A., Ackermann, M.A., Bowman, A.L., Yap, S.V., and Bloch, R.J. (2009) Muscle giants: molecular scaffolds in sarcomerogenesis. Physiol.Rev. 89, 1217-1267 116. Kontrogianni-Konstantopoulos, A., Jones, E.M., Van Rossum, D.B., and Bloch, R.J. (2003) Obscurin is a ligand for small ankyrin 1 in skeletal muscle. Mol.Biol.Cell. 14, 1138-1148 117. Kontrogianni-Konstantopoulos, A., and Bloch, R.J. (2003) The hydrophilic domain of small ankyrin-1 interacts with the two N-terminal immunoglobulin domains of titin. J.Biol.Chem. 278, 3985-3991 118. Bagnato, P., Barone, V., Giacomello, E., Rossi, D., and Sorrentino, V. (2003) Binding of an ankyrin-1 isoform to obscurin suggests a molecular link between the sarcoplasmic reticulum and myofibrils in striated muscles. J.Cell Biol. 160, 245-253 119. Willis, C.D., Oashi, T., Busby, B., Mackerell, A.D.,Jr, and Bloch, R.J. (2012) Hydrophobic residues in small ankyrin 1 participate in binding to obscurin. Mol.Membr.Biol. 29, 36-51 120. Young, P., Ehler, E., and Gautel, M. (2001) Obscurin, a giant sarcomeric Rho guanine nucleotide exchange factor protein involved in sarcomere assembly. J.Cell Biol. 154, 123-136 121. Mues, A., van der Ven, P.F., Young, P., Furst, D.O., and Gautel, M. (1998) Two immunoglobulin-like domains of the Z-disc portion of titin interact in a conformationdependent way with telethonin. FEBS Lett. 428, 111-114 122. Lange, S., Ouyang, K., Meyer, G., Cui, L., Cheng, H., Lieber, R.L., and Chen, J. (2009) Obscurin determines the architecture of the longitudinal sarcoplasmic reticulum. J.Cell.Sci. 122, 2640-2650 123. Lange, S., Perera, S., Teh, P., and Chen, J. (2012) Obscurin and KCTD6 regulate cullin-dependent small ankyrin-1 (sAnk1.5) protein turnover. Mol.Biol.Cell. 23, 24902504 124. Giacomello, E., Quarta, M., Paolini, C., Squecco, R., Fusco, P., Toniolo, L., Blaauw, B., Formoso, L., Rossi, D., Birkenmeier, C., Peters, L.L., Francini, F., Protasi, F., Reggiani, C., and Sorrentino, V. (2015) Deletion of small ankyrin 1 (sAnk1) isoforms results in structural and functional alterations in aging skeletal muscle fibers. Am.J.Physiol.Cell.Physiol. 308, C123-38 125. Ackermann, M.A., Ziman, A.P., Strong, J., Zhang, Y., Hartford, A.K., Ward, C.W., Randall, W.R., Kontrogianni-Konstantopoulos, A., and Bloch, R.J. (2011) Integrity of the network sarcoplasmic reticulum in skeletal muscle requires small ankyrin 1. J.Cell.Sci. 124, 3619-3630 142
126. Brini, M., and Carafoli, E. (2009) Calcium pumps in health and disease. Physiol.Rev. 89, 1341-1378 127. Chami, M., Gozuacik, D., Saigo, K., Capiod, T., Falson, P., Lecoeur, H., Urashima, T., Beckmann, J., Gougeon, M.L., Claret, M., le Maire, M., Brechot, C., and PaterliniBrechot, P. (2000) Hepatitis B virus-related insertional mutagenesis implicates SERCA1 gene in the control of apoptosis. Oncogene. 19, 2877-2886 128. Korosec, B., Glavac, D., Rott, T., and Ravnik-Glavac, M. (2006) Alterations in the ATP2A2 gene in correlation with colon and lung cancer. Cancer Genet.Cytogenet. 171, 105-111 129. Korosec, B., Glavac, D., Volavsek, M., and Ravnik-Glavac, M. (2008) Alterations in genes encoding sarcoplasmic-endoplasmic reticulum Ca(2+) pumps in association with head and neck squamous cell carcinoma. Cancer Genet.Cytogenet. 181, 112-118 130. Divet, A., Lompre, A.M., and Huchet-Cadiou, C. (2005) Effect of cyclopiazonic acid, an inhibitor of the sarcoplasmic reticulum Ca-ATPase, on skeletal muscles from normal and mdx mice. Acta Physiol.Scand. 184, 173-186 131. Divet, A., and Huchet-Cadiou, C. (2002) Sarcoplasmic reticulum function in slowand fast-twitch skeletal muscles from mdx mice. Pflugers Arch. 444, 634-643 132. Millay, D.P., Goonasekera, S.A., Sargent, M.A., Maillet, M., Aronow, B.J., and Molkentin, J.D. (2009) Calcium influx is sufficient to induce muscular dystrophy through a TRPC-dependent mechanism. Proc.Natl.Acad.Sci.U.S.A. 106, 19023-19028 133. Spencer, M.J., Croall, D.E., and Tidball, J.G. (1995) Calpains are activated in necrotic fibers from mdx dystrophic mice. J.Biol.Chem. 270, 10909-10914 134. Spencer, M.J., and Mellgren, R.L. (2002) Overexpression of a calpastatin transgene in mdx muscle reduces dystrophic pathology. Hum.Mol.Genet. 11, 2645-2655 135. Millay, D.P., Sargent, M.A., Osinska, H., Baines, C.P., Barton, E.R., Vuagniaux, G., Sweeney, H.L., Robbins, J., and Molkentin, J.D. (2008) Genetic and pharmacologic inhibition of mitochondrial-dependent necrosis attenuates muscular dystrophy. Nat.Med. 14, 442-447 136. Goonasekera, S.A., Lam, C.K., Millay, D.P., Sargent, M.A., Hajjar, R.J., Kranias, E.G., and Molkentin, J.D. (2011) Mitigation of muscular dystrophy in mice by SERCA overexpression in skeletal muscle. J.Clin.Invest. 121, 1044-1052 137. Huang, B., Wang, S., Qin, D., Boutjdir, M., and El-Sherif, N. (1999) Diminished basal phosphorylation level of phospholamban in the postinfarction remodeled rat ventricle: role of beta-adrenergic pathway, G(i) protein, phosphodiesterase, and phosphatases. Circ.Res. 85, 848-855 143
138. Kranias, E.G., and Bers, D.M. (2007) Calcium and cardiomyopathies. Subcell.Biochem. 45, 523-537 139. Richard, S., Leclercq, F., Lemaire, S., Piot, C., and Nargeot, J. (1998) Ca2+ currents in compensated hypertrophy and heart failure. Cardiovasc.Res. 37, 300-311 140. Schwinger, R.H., Munch, G., Bolck, B., Karczewski, P., Krause, E.G., and Erdmann, E. (1999) Reduced Ca(2+)-sensitivity of SERCA 2a in failing human myocardium due to reduced serin-16 phospholamban phosphorylation. J.Mol.Cell.Cardiol. 31, 479-491 141. Adachi, T. (2010) Modulation of vascular sarco/endoplasmic reticulum calcium ATPase in cardiovascular pathophysiology. Adv.Pharmacol. 59, 165-195 142. Diaz, M.E., Graham, H.K., O'neill, S.C., Trafford, A.W., and Eisner, D.A. (2005) The control of sarcoplasmic reticulum Ca content in cardiac muscle. Cell Calcium. 38, 391-396 143. Schmidt, A.G., Zhai, J., Carr, A.N., Gerst, M.J., Lorenz, J.N., Pollesello, P., Annila, A., Hoit, B.D., and Kranias, E.G. (2002) Structural and functional implications of the phospholamban hinge domain: impaired SR Ca2+ uptake as a primary cause of heart failure. Cardiovasc.Res. 56, 248-259 144. Vangheluwe, P., Tjwa, M., Van Den Bergh, A., Louch, W.E., Beullens, M., Dode, L., Carmeliet, P., Kranias, E., Herijgers, P., Sipido, K.R., Raeymaekers, L., and Wuytack, F. (2006) A SERCA2 pump with an increased Ca2+ affinity can lead to severe cardiac hypertrophy, stress intolerance and reduced life span. J.Mol.Cell.Cardiol. 41, 308-317 145. Vangheluwe, P., Schuermans, M., Zador, E., Waelkens, E., Raeymaekers, L., and Wuytack, F. (2005) Sarcolipin and phospholamban mRNA and protein expression in cardiac and skeletal muscle of different species. Biochem.J. 389, 151-159 146. Gayan-Ramirez, G., Vanzeir, L., Wuytack, F., and Decramer, M. (2000) Corticosteroids decrease mRNA levels of SERCA pumps, whereas they increase sarcolipin mRNA in the rat diaphragm. J.Physiol. 524 Pt 2, 387-397 147. Afara, M.R., Trieber, C.A., Glaves, J.P., and Young, H.S. (2006) Rational design of peptide inhibitors of the sarcoplasmic reticulum calcium pump. Biochemistry. 45, 86178627 148. Hutter, M.C., Krebs, J., Meiler, J., Griesinger, C., Carafoli, E., and Helms, V. (2002) A structural model of the complex formed by phospholamban and the calcium pump of sarcoplasmic reticulum obtained by molecular mechanics. Chembiochem. 3, 1200-1208 149. Seidel, K., Andronesi, O.C., Krebs, J., Griesinger, C., Young, H.S., Becker, S., and Baldus, M. (2008) Structural characterization of Ca(2+)-ATPase-bound phospholamban 144
in lipid bilayers by solid-state nuclear magnetic resonance (NMR) spectroscopy. Biochemistry. 47, 4369-4376 150. Toyoshima, C., Asahi, M., Sugita, Y., Khanna, R., Tsuda, T., and MacLennan, D.H. (2003) Modeling of the inhibitory interaction of phospholamban with the Ca2+ ATPase. Proc.Natl.Acad.Sci.U.S.A. 100, 467-472 151. Traaseth, N.J., Ha, K.N., Verardi, R., Shi, L., Buffy, J.J., Masterson, L.R., and Veglia, G. (2008) Structural and dynamic basis of phospholamban and sarcolipin inhibition of Ca(2+)-ATPase. Biochemistry. 47, 3-13 152. Harrer, J.M., and Kranias, E.G. (1994) Characterization of the molecular form of cardiac phospholamban. Mol.Cell.Biochem. 140, 185-193 153. Li, M., Reddy, L.G., Bennett, R., Silva, N.D.,Jr, Jones, L.R., and Thomas, D.D. (1999) A fluorescence energy transfer method for analyzing protein oligomeric structure: application to phospholamban. Biophys.J. 76, 2587-2599 154. Traaseth, N.J., Verardi, R., Torgersen, K.D., Karim, C.B., Thomas, D.D., and Veglia, G. (2007) Spectroscopic validation of the pentameric structure of phospholamban. Proc.Natl.Acad.Sci.U.S.A. 104, 14676-14681 155. Watanabe, Y., Kijima, Y., Kadoma, M., Tada, M., and Takagi, T. (1991) Molecular weight determination of phospholamban oligomer in the presence of sodium dodecyl sulfate: application of low-angle laser light scattering photometry. J.Biochem. 110, 40-45 156. Gramolini, A.O., Kislinger, T., Asahi, M., Li, W., Emili, A., and MacLennan, D.H. (2004) Sarcolipin retention in the endoplasmic reticulum depends on its C-terminal RSYQY sequence and its interaction with sarco(endo)plasmic Ca(2+)-ATPases. Proc.Natl.Acad.Sci.U.S.A. 101, 16807-16812 157. Birkenmeier, C.S., White, R.A., Peters, L.L., Hall, E.J., Lux, S.E., and Barker, J.E. (1993) Complex patterns of sequence variation and multiple 5' and 3' ends are found among transcripts of the erythroid ankyrin gene. J.Biol.Chem. 268, 9533-9540 158. Hopitzan, A.A., Baines, A.J., and Kordeli, E. (2006) Molecular evolution of ankyrin: gain of function in vertebrates by acquisition of an obscurin/titin-binding-related domain. Mol.Biol.Evol. 23, 46-55 159. Gokhin, D.S., and Fowler, V.M. (2011) Cytoplasmic gamma-actin and tropomodulin isoforms link to the sarcoplasmic reticulum in skeletal muscle fibers. J.Cell Biol. 194, 105-120 160. Kontrogianni-Konstantopoulos, A., Catino, D.H., Strong, J.C., Randall, W.R., and Bloch, R.J. (2004) Obscurin regulates the organization of myosin into A bands. Am.J.Physiol.Cell.Physiol. 287, C209-17 145
161. Rizzo, M.A., Springer, G., Segawa, K., Zipfel, W.R., and Piston, D.W. (2006) Optimization of pairings and detection conditions for measurement of FRET between cyan and yellow fluorescent proteins. Microsc.Microanal. 12, 238-254 162. Markwardt, M.L., Kremers, G.J., Kraft, C.A., Ray, K., Cranfill, P.J., Wilson, K.A., Day, R.N., Wachter, R.M., Davidson, M.W., and Rizzo, M.A. (2011) An improved cerulean fluorescent protein with enhanced brightness and reduced reversible photoswitching. PLoS One. 6, e17896 163. Fu, M.H., and Tupling, A.R. (2009) Protective effects of Hsp70 on the structure and function of SERCA2a expressed in HEK-293 cells during heat stress. Am.J.Physiol.Heart Circ.Physiol. 296, H1175-83 164. Asahi, M., Kimura, Y., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1999) Transmembrane helix M6 in sarco(endo)plasmic reticulum Ca(2+)-ATPase forms a functional interaction site with phospholamban. Evidence for physical interactions at other sites. J.Biol.Chem. 274, 32855-32862 165. Eletr, S., and Inesi, G. (1972) Phase changes in the lipid moieties of sarcoplasmic reticulum membranes induced by temperature and protein conformational changes. Biochim.Biophys.Acta. 290, 178-185 166. Kosk-Kosicka, D. (2013) Measurement of Ca(2)(+)-ATPase activity (in PMCA and SERCA1). Methods Mol.Biol. 937, 343-356 167. Maruyama, K., and MacLennan, D.H. (1988) Mutation of aspartic acid-351, lysine352, and lysine-515 alters the Ca2+ transport activity of the Ca2+-ATPase expressed in COS-1 cells. Proc.Natl.Acad.Sci.U.S.A. 85, 3314-3318 168. Lencesova, L., O'Neill, A., Resneck, W.G., Bloch, R.J., and Blaustein, M.P. (2004) Plasma membrane-cytoskeleton-endoplasmic reticulum complexes in neurons and astrocytes. J.Biol.Chem. 279, 2885-2893 169. Bolte, S., and Cordelieres, F.P. (2006) A guided tour into subcellular colocalization analysis in light microscopy. J.Microsc. 224, 213-232 170. Piston, D.W., and Rizzo, M.A. (2008) FRET by fluorescence polarization microscopy. Methods Cell Biol. 85, 415-430 171. Gade, P., Ramachandran, G., Maachani, U.B., Rizzo, M.A., Okada, T., Prywes, R., Cross, A.S., Mori, K., and Kalvakolanu, D.V. (2012) An IFN-gamma-stimulated ATF6C/EBP-beta-signaling pathway critical for the expression of Death Associated Protein Kinase 1 and induction of autophagy. Proc.Natl.Acad.Sci.U.S.A. 109, 10316-10321 172. Rizzo, M.A., and Piston, D.W. (2005) High-contrast imaging of fluorescent protein FRET by fluorescence polarization microscopy. Biophys.J. 88, L14-6 146
173. Kontrogianni-Konstantopoulos, A., Huang, S.C., and Benz, E.J.,Jr (2000) A nonerythroid isoform of protein 4.1R interacts with components of the contractile apparatus in skeletal myofibers. Mol.Biol.Cell. 11, 3805-3817 174. Zhang, Y. (2008) I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 9, 40-2105-9-40 175. Comeau, S.R., Gatchell, D.W., Vajda, S., and Camacho, C.J. (2004) ClusPro: a fully automated algorithm for protein-protein docking. Nucleic Acids Res. 32, W96-9 176. Comeau, S.R., Gatchell, D.W., Vajda, S., and Camacho, C.J. (2004) ClusPro: an automated docking and discrimination method for the prediction of protein complexes. Bioinformatics. 20, 45-50 177. Kozakov, D., Brenke, R., Comeau, S.R., and Vajda, S. (2006) PIPER: an FFT-based protein docking program with pairwise potentials. Proteins. 65, 392-406 178. Kozakov, D., Beglov, D., Bohnuud, T., Mottarella, S.E., Xia, B., Hall, D.R., and Vajda, S. (2013) How good is automated protein docking?. Proteins. 81, 2159-2166 179. Guex, N., and Peitsch, M.C. (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis. 18, 2714-2723 180. Sahoo, S.K., Shaikh, S.A., Sopariwala, D.H., Bal, N.C., Bruhn, D.S., Kopec, W., Khandelia, H., and Periasamy, M. (2015) The N-Terminus of Sarcolipin plays an important role in uncoupling Sarco-endoplasmic Reticulum Ca2+ ATPase (SERCA) ATP hydrolysis from Ca2+ transport. J.Biol.Chem. 181. Senes, A., Gerstein, M., and Engelman, D.M. (2000) Statistical analysis of amino acid patterns in transmembrane helices: the GxxxG motif occurs frequently and in association with beta-branched residues at neighboring positions. J.Mol.Biol. 296, 921936 182. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990) Basic local alignment search tool. J.Mol.Biol. 215, 403-410 183. Shen, X., Franzini-Armstrong, C., Lopez, J.R., Jones, L.R., Kobayashi, Y.M., Wang, Y., Kerrick, W.G., Caswell, A.H., Potter, J.D., Miller, T., Allen, P.D., and Perez, C.F. (2007) Triadins modulate intracellular Ca(2+) homeostasis but are not essential for excitation-contraction coupling in skeletal muscle. J.Biol.Chem. 282, 37864-37874 184. Kerr, J.P., Ward, C.W., and Bloch, R.J. (2014) Dysferlin at transverse tubules regulates Ca(2+) homeostasis in skeletal muscle. Front.Physiol. 5, 89 185. Abrol, N., Smolin, N., Armanious, G., Ceholski, D.K., Trieber, C.A., Young, H.S., and Robia, S.L. (2014) Phospholamban C-terminal residues are critical determinants of 147
the structure and function of the calcium ATPase regulatory complex. J.Biol.Chem. 289, 25855-25866 186. Toyofuku, T., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1993) Identification of regions in the Ca(2+)-ATPase of sarcoplasmic reticulum that affect functional association with phospholamban. J.Biol.Chem. 268, 2809-2815 187. Förster, T. (1948) Zwischenmolekulare Energiewanderung und Fluoreszenz. Annalen der Physik. 437, 55-75 188. Kimura, Y., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1997) Phospholamban inhibitory function is activated by depolymerization. J.Biol.Chem. 272, 15061-15064 189. Kimura, Y., Asahi, M., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (1998) Phospholamban domain Ib mutations influence functional interactions with the Ca2+ATPase isoform of cardiac sarcoplasmic reticulum. J.Biol.Chem. 273, 14238-14241 190. Honarnejad, K., and Herms, J. (2012) Presenilins: role in calcium homeostasis. Int.J.Biochem.Cell Biol. 44, 1983-1986 191. Yu, J.T., Chang, R.C., and Tan, L. (2009) Calcium dysregulation in Alzheimer's disease: from mechanisms to therapeutic opportunities. Prog.Neurobiol. 89, 240-255 192. Desmond, P.F., Muriel, J., Markwardt, M.L., Rizzo, M.A., and Bloch, R.J. (2015) Identification of Small Ankyrin 1 as a Novel Sarco(endo)plasmic Reticulum Ca2+ATPase 1 (SERCA1) Regulatory Protein in Skeletal Muscle. J.Biol.Chem. 193. Asahi, M., Kurzydlowski, K., Tada, M., and MacLennan, D.H. (2002) Sarcolipin inhibits polymerization of phospholamban to induce superinhibition of sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs). J.Biol.Chem. 277, 2672526728 194. Toyoshima, C., Iwasawa, S., Ogawa, H., Hirata, A., Tsueda, J., and Inesi, G. (2013) Crystal structures of the calcium pump and sarcolipin in the Mg2+-bound E1 state. Nature. 495, 260-264 195. Sonnino, S., and Prinetti, A. (2013) Membrane domains and the "lipid raft" concept. Curr.Med.Chem. 20, 4-21 196. Schneider, J.S., Shanmugam, M., Gonzalez, J.P., Lopez, H., Gordan, R., Fraidenraich, D., and Babu, G.J. (2013) Increased sarcolipin expression and decreased sarco(endo)plasmic reticulum Ca2+ uptake in skeletal muscles of mouse models of Duchenne muscular dystrophy. J.Muscle Res.Cell.Motil. 34, 349-356
148
197. Muir, L.A., and Chamberlain, J.S. (2009) Emerging strategies for cell and gene therapy of the muscular dystrophies. Expert Rev.Mol.Med. 11, e18 198. Mercuri, E., and Muntoni, F. (2013) Muscular dystrophies. The Lancet. 381, 845860 199. Sienkiewicz, D., Kulak, W., Okurowska-Zawada, B., Paszko-Patej, G., and Kawnik, K. (2015) Duchenne muscular dystrophy: current cell therapies. Ther.Adv.Neurol.Disord. 8, 166-177 200. Lapidos, K.A., Kakkar, R., and McNally, E.M. (2004) The dystrophin glycoprotein complex: signaling strength and integrity for the sarcolemma. Circ.Res. 94, 1023-1031 201. Mokri, B., and Engel, A.G. (1975) Duchenne dystrophy: electron microscopic findings pointing to a basic or early abnormality in the plasma membrane of the muscle fiber. Neurology. 25, 1111-1120 202. Alderton, J.M., and Steinhardt, R.A. (2000) Calcium influx through calcium leak channels is responsible for the elevated levels of calcium-dependent proteolysis in dystrophic myotubes. J.Biol.Chem. 275, 9452-9460 203. Hopf, F.W., Turner, P.R., and Steinhardt, R.A. (2007) Calcium misregulation and the pathogenesis of muscular dystrophy. Subcell.Biochem. 45, 429-464 204. Turner, P.R., Fong, P.Y., Denetclaw, W.F., and Steinhardt, R.A. (1991) Increased calcium influx in dystrophic muscle. J.Cell Biol. 115, 1701-1712 205. Turner, P.R., Westwood, T., Regen, C.M., and Steinhardt, R.A. (1988) Increased protein degradation results from elevated free calcium levels found in muscle from mdx mice. Nature. 335, 735-738 206. Matsumura, K., Ervasti, J.M., Ohlendieck, K., Kahl, S.D., and Campbell, K.P. (1992) Association of dystrophin-related protein with dystrophin-associated proteins in mdx mouse muscle. Nature. 360, 588-591 207. Allen, D.G., Gervasio, O.L., Yeung, E.W., and Whitehead, N.P. (2010) Calcium and the damage pathways in muscular dystrophy. Can.J.Physiol.Pharmacol. 88, 83-91 208. Alderton, J.M., and Steinhardt, R.A. (2000) How calcium influx through calcium leak channels is responsible for the elevated levels of calcium-dependent proteolysis in dystrophic myotubes. Trends Cardiovasc.Med. 10, 268-272 209. Edwards, J.N., Friedrich, O., Cully, T.R., von Wegner, F., Murphy, R.M., and Launikonis, B.S. (2010) Upregulation of store-operated Ca2+ entry in dystrophic mdx mouse muscle. Am.J.Physiol.Cell.Physiol. 299, C42-50
149
210. Vandebrouck, C., Martin, D., Colson-Van Schoor, M., Debaix, H., and Gailly, P. (2002) Involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. J.Cell Biol. 158, 1089-1096 211. Robin, G., Berthier, C., and Allard, B. (2012) Sarcoplasmic reticulum Ca2+ permeation explored from the lumen side in mdx muscle fibers under voltage control. J.Gen.Physiol. 139, 209-218 212. Capote, J., DiFranco, M., and Vergara, J.L. (2010) Excitation-contraction coupling alterations in mdx and utrophin/dystrophin double knockout mice: a comparative study. Am.J.Physiol.Cell.Physiol. 298, C1077-86 213. Collet, C., Allard, B., Tourneur, Y., and Jacquemond, V. (1999) Intracellular calcium signals measured with indo-1 in isolated skeletal muscle fibres from control and mdx mice. J.Physiol. 520 Pt 2, 417-429 214. Woods, C.E., Novo, D., DiFranco, M., and Vergara, J.L. (2004) The action potential-evoked sarcoplasmic reticulum calcium release is impaired in mdx mouse muscle fibres. J.Physiol. 557, 59-75 215. Bellinger, A.M., Reiken, S., Carlson, C., Mongillo, M., Liu, X., Rothman, L., Matecki, S., Lacampagne, A., and Marks, A.R. (2009) Hypernitrosylated ryanodine receptor calcium release channels are leaky in dystrophic muscle. Nat.Med. 15, 325-330 216. Kargacin, M.E., and Kargacin, G.J. (1996) The sarcoplasmic reticulum calcium pump is functionally altered in dystrophic muscle. Biochim.Biophys.Acta. 1290, 4-8 217. Gehrig, S.M., van der Poel, C., Sayer, T.A., Schertzer, J.D., Henstridge, D.C., Church, J.E., Lamon, S., Russell, A.P., Davies, K.E., Febbraio, M.A., and Lynch, G.S. (2012) Hsp72 preserves muscle function and slows progression of severe muscular dystrophy. Nature. 484, 394-398 218. Gehrig, S.M., Koopman, R., Naim, T., Tjoakarfa, C., and Lynch, G.S. (2010) Making fast-twitch dystrophic muscles bigger protects them from contraction injury and attenuates the dystrophic pathology. Am.J.Pathol. 176, 29-33 219. Fauconnier, J., Thireau, J., Reiken, S., Cassan, C., Richard, S., Matecki, S., Marks, A.R., and Lacampagne, A. (2010) Leaky RyR2 trigger ventricular arrhythmias in Duchenne muscular dystrophy. Proc.Natl.Acad.Sci.U.S.A. 107, 1559-1564 220. Goonasekera, S.A., Lam, C.K., Millay, D.P., Sargent, M.A., Hajjar, R.J., Kranias, E.G., and Molkentin, J.D. (2011) Mitigation of muscular dystrophy in mice by SERCA overexpression in skeletal muscle. J.Clin.Invest. 121, 1044-1052
150
221. Morine, K.J., Sleeper, M.M., Barton, E.R., and Sweeney, H.L. (2010) Overexpression of SERCA1a in the mdx diaphragm reduces susceptibility to contractioninduced damage. Hum.Gene Ther. 21, 1735-1739 222. Mazala, D.A., Pratt, S.J., Chen, D., Molkentin, J.D., Lovering, R.M., and Chin, E.R. (2015) SERCA1 overexpression minimizes skeletal muscle damage in dystrophic mouse models. Am.J.Physiol.Cell.Physiol. 308, C699-709 223. Lemas, M.V., Hamrick, M., Takeyasu, K., and Fambrough, D.M. (1994) 26 amino acids of an extracellular domain of the Na,K-ATPase alpha-subunit are sufficient for assembly with the Na,K-ATPase beta-subunit. J.Biol.Chem. 269, 8255-8259 224. Ishii, T., and Takeyasu, K. (1995) The C-terminal 165 amino acids of the plasma membrane Ca(2+)-ATPase confer Ca2+/calmodulin sensitivity on the Na+,K(+)-ATPase alpha-subunit. EMBO J. 14, 58-67 225. Foletti, D., Guerini, D., and Carafoli, E. (1995) Subcellular targeting of the endoplasmic reticulum and plasma membrane Ca2+ pumps: a study using recombinant chimeras. FASEB J. 9, 670-680 226. Kanno, A., Ozawa, T., and Umezawa, Y. (2011) Detection of protein-protein interactions in bacteria by GFP-fragment reconstitution. Methods Mol.Biol. 705, 251-258 227. Liu, M., and Barth, A. (2003) TNP-AMP binding to the sarcoplasmic reticulum Ca(2+)-ATPase studied by infrared spectroscopy. Biophys.J. 85, 3262-3270 228. Matsuno, K., Go, M.J., Sun, X., Eastman, D.S., and Artavanis-Tsakonas, S. (1997) Suppressor of Hairless-independent events in Notch signaling imply novel pathway elements. Development. 124, 4265-4273 229. Jonas-Straube, E., Hutin, C., Hoffman, N.E., and Schunemann, D. (2001) Functional analysis of the protein-interacting domains of chloroplast SRP43. J.Biol.Chem. 276, 24654-24660 230. Lin, J.H., Makris, A., McMahon, C., Bear, S.E., Patriotis, C., Prasad, V.R., Brent, R., Golemis, E.A., and Tsichlis, P.N. (1999) The ankyrin repeat-containing adaptor protein Tvl-1 is a novel substrate and regulator of Raf-1. J.Biol.Chem. 274, 14706-14715 231. Demontis, F., Piccirillo, R., Goldberg, A.L., and Perrimon, N. (2013) Mechanisms of skeletal muscle aging: insights from Drosophila and mammalian models. Dis.Model.Mech. 6, 1339-1352
151